fut10

Ensembl ID:
ENSDARG00000029601
ZFIN ID:
ZDB-GENE-081022-183
Description:
Alpha-(1,3)-fucosyltransferase 10 [Source:UniProtKB/Swiss-Prot;Acc:Q5F2N3]
Human Orthologue:
FUT10
Human Description:
fucosyltransferase 10 (alpha (1,3) fucosyltransferase) [Source:HGNC Symbol;Acc:19234]
Mouse Orthologue:
Fut10
Mouse Description:
fucosyltransferase 10 Gene [Source:MGI Symbol;Acc:MGI:2384748]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1757 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042311 Nonsense 16 464 1 4
Genomic Location:
Chromosome 10 (position 5853964)
KASP Assay ID:
554-1750.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCATGGACGGAGTGTTTAACATGAGGCGAATCTCCGTGAAAAAACTTTG[T/A]WCTTTTTGTCTCTGCGCGTGTGCGTTTGCGTTTTTAGTCATGACATTTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tltw1aab