trim55a

Ensembl ID:
ENSDARG00000029596
ZFIN ID:
ZDB-GENE-040718-50
Description:
tripartite motif-containing 55 [Source:RefSeq peptide;Acc:NP_001002358]
Human Orthologue:
TRIM55
Human Description:
tripartite motif-containing 55 [Source:HGNC Symbol;Acc:14215]
Mouse Orthologue:
Trim55
Mouse Description:
tripartite motif-containing 55 Gene [Source:MGI Symbol;Acc:MGI:3036269]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7518 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047055 Missense 283 443 7 10
Genomic Location:
Chromosome 2 (position 42223300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACCAAGTTTTTCTAGTGAAAKTTCTTATCAATATRTCTCTCTTACAG[A/T]ACACGAAGCCTCTGCTACAACAGTAAGAACCAGATATTTATCTTTATTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/imni0obl