id2b

Ensembl ID:
ENSDARG00000029544
ZFIN ID:
ZDB-GENE-030131-15
Description:
inhibitor of DNA binding 2, dominant negative helix-loop-helix protein, b [Source:RefSeq peptide;Ac
Human Orthologue:
ID2
Human Description:
inhibitor of DNA binding 2, dominant negative helix-loop-helix protein [Source:HGNC Symbol;Acc:5361]
Mouse Orthologue:
Id2
Mouse Description:
inhibitor of DNA binding 2 Gene [Source:MGI Symbol;Acc:MGI:96397]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23730 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048759 Nonsense 101 130 1 2
ENSDART00000125348 Nonsense 101 130 1 3
Genomic Location (Zv9):
Chromosome 20 (position 29812770)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29883983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCAGCAGCAGAGCCTCGGACAGAGCCCTCCAAAAAAGACTGTCAGAT[C/A]ACTGGGAGCTGATATCAGCATCATCTCTTTCCAGGTAAGGCAAGTTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgE levels : A genome-wide association study of plasma total IgE concentrations in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link