impdh1b

Ensembl ID:
ENSDARG00000029524
ZFIN ID:
ZDB-GENE-030219-206
Description:
inosine monophosphate dehydrogenase 1 [Source:RefSeq peptide;Acc:NP_001014391]
Human Orthologue:
IMPDH1
Human Description:
IMP (inosine 5'-monophosphate) dehydrogenase 1 [Source:HGNC Symbol;Acc:6052]
Mouse Orthologue:
Impdh1
Mouse Description:
inosine 5'-phosphate dehydrogenase 1 Gene [Source:MGI Symbol;Acc:MGI:96567]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33452 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33453 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045866 Essential Splice Site 228 537 7 15
ENSDART00000066973 Essential Splice Site 232 539 8 16
ENSDART00000066975 Essential Splice Site 207 514 7 15
ENSDART00000139730   None 126 None 4
Genomic Location (Zv9):
Chromosome 4 (position 18046062)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18988902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTCACATTAAAAGAAGCCAATGACATCCTGCAACGCAGCAAAAAAGG[T/G]AACAACAAACAGATTGTGAAATTATATCATCGTAGCCATTAACTGAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045866 Nonsense 416 537 12 15
ENSDART00000066973 Nonsense 420 539 13 16
ENSDART00000066975 Nonsense 395 514 12 15
ENSDART00000139730   None 126 None 4
Genomic Location (Zv9):
Chromosome 4 (position 18050049)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18992889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTTTTGTGCGCAGTGATGATGGGGTCTTTGCTGGCCGCCACCACC[G/T]AAGCTCCGGGAGAGTATTTCTTCTCTGATGGGGTGAGACTGAAGAAATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link