timm17a

Ensembl ID:
ENSDARG00000029510
ZFIN ID:
ZDB-GENE-031030-6
Description:
mitochondrial import inner membrane translocase subunit Tim17-A [Source:RefSeq peptide;Acc:NP_93818
Human Orthologue:
TIMM17A
Human Description:
translocase of inner mitochondrial membrane 17 homolog A (yeast) [Source:HGNC Symbol;Acc:17315]
Mouse Orthologue:
Timm17a
Mouse Description:
translocase of inner mitochondrial membrane 17a Gene [Source:MGI Symbol;Acc:MGI:1343131]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2587 Nonsense F2 line generated During 2016
sa35084 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2587
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044987   None 166 None 6
ENSDART00000127976 Nonsense 18 201 1 6

The following transcripts of ENSDARG00000029510 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 25833773)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24662598
KASP Assay ID:
554-2573.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCRCACAGAAAGAACCAGCGAAAAACGCACGAGGAACCTTACGTCACT[T/A]GCAGCAACAGCACGTGCTTGGTTACGTCAGTTGTGAACGGGAAAAGAACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa35084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044987 Nonsense 4 166 1 6
ENSDART00000127976 Nonsense 39 201 1 6

The following transcripts of ENSDARG00000029510 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 25833837)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24662662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTTGGTTACGTCAGTTGTGAACGGGAAAAGAACAAAATGGAGGAGTA[C/A]GCGAGGGAGCCGTGGTGAGCCGACAGCCTCAAACCTATTATTTTATACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link