si:ch211-39e15.2

Ensembl ID:
ENSDARG00000029501
ZFIN ID:
ZDB-GENE-060503-796
Description:
glycogen synthase kinase 3 alpha [Source:RefSeq peptide;Acc:NP_001038386]
Human Orthologue:
GSK3A
Human Description:
glycogen synthase kinase 3 alpha [Source:HGNC Symbol;Acc:4616]
Mouse Orthologue:
Gsk3a
Mouse Description:
glycogen synthase kinase 3 alpha Gene [Source:MGI Symbol;Acc:MGI:2152453]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29147 Nonsense Mutation detected in F1 DNA During 2017
sa36771 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049707 Nonsense 211 462 4 10
ENSDART00000082012 Nonsense 211 359 4 11
ENSDART00000122065 Nonsense 211 359 4 8
ENSDART00000143941 Nonsense 211 462 4 10
Genomic Location (Zv9):
Chromosome 19 (position 6699047)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6157722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTGGCTCGACACTTTAGCAAGGCTAAAACCATTATTCCCATCTTTTA[T/A]GTGAAGGTAAAGTTGACCAAACAAATGATCTCAACATCTTACAACAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049707 Nonsense 377 462 8 10
ENSDART00000082012   None 359 8 11
ENSDART00000122065   None 359 None 8
ENSDART00000143941 Nonsense 377 462 8 10
Genomic Location (Zv9):
Chromosome 19 (position 6692023)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 6150698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGAACTCCTCCTGAGGCGATCGCGCTGTGCTCTCGGCTGTTGGAGTA[T/G]ACGCCAGTGACTCGGCTGTCTCCGCTTCAGGCTTGTGCTCATGCCTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link