tfcp2l1

Ensembl ID:
ENSDARG00000029497
ZFIN ID:
ZDB-GENE-040704-58
Description:
transcription factor CP2-like 1 [Source:RefSeq peptide;Acc:NP_001002214]
Human Orthologue:
AC015910.1

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18247 Essential Splice Site Available for shipment Available now
sa16603 Essential Splice Site Available for shipment Available now
sa8746 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040480 Essential Splice Site 164 397 5 15
ENSDART00000111960 Essential Splice Site 164 472 5 16
ENSDART00000146663 Essential Splice Site 164 468 5 15

The following transcripts of ENSDARG00000029497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39351460)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38489356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCGAATTCCTCTGGGATCCTGACAAAAATGCCTCTGTCTTCATKCAGG[T/C]AGAGCTTTTCTTTTATTTCTGAAGTGAGAAACATTAGCGGTAACTTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040480 Essential Splice Site 253 397 8 15
ENSDART00000111960 Essential Splice Site 253 472 8 16
ENSDART00000146663 Essential Splice Site 253 468 8 15
ENSDART00000040480 Essential Splice Site 253 397 8 15
ENSDART00000111960 Essential Splice Site 253 472 8 16
ENSDART00000146663 Essential Splice Site 253 468 8 15

The following transcripts of ENSDARG00000029497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39355231)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38493127
KASP Assay ID:
2260-2195.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGAATAAGGTCAATATTCTTTGTAATAAGKACATTTCTTTTTCTTTY[A/G]GTGCTCCCCTTGGCCCGAAGCCCCATCCATCAGCAGCACGAGCAACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040480 Essential Splice Site 253 397 8 15
ENSDART00000111960 Essential Splice Site 253 472 8 16
ENSDART00000146663 Essential Splice Site 253 468 8 15
ENSDART00000040480 Essential Splice Site 253 397 8 15
ENSDART00000111960 Essential Splice Site 253 472 8 16
ENSDART00000146663 Essential Splice Site 253 468 8 15

The following transcripts of ENSDARG00000029497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39355231)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38493127
KASP Assay ID:
2260-2195.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGAATAAGGTCAATATTCTTTGTAATAAGTACATTTCTTTTTCTTTY[A/G]GTGCTCCCCTTGGCCCGAAGCCCCATCCATCAGCAGCACGAGCAACACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link