ush2a

Ensembl ID:
ENSDARG00000029482
ZFIN ID:
ZDB-GENE-060503-794
Description:
Novel protein similar to vertebrate Usher syndrome 2A (Autosomal recessive, mild) (USH2A) [Source:Un
Human Orthologue:
USH2A
Human Description:
Usher syndrome 2A (autosomal recessive, mild) [Source:HGNC Symbol;Acc:12601]
Mouse Orthologue:
Ush2a
Mouse Description:
Usher syndrome 2A (autosomal recessive, mild) homolog (human) Gene [Source:MGI Symbol;Acc:MGI:134129

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16626 Nonsense Available for shipment Available now
sa14011 Nonsense Available for shipment Available now
sa23107 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23106 Nonsense Mutation detected in F1 DNA During 2014
sa3997 Nonsense Mutation detected in F1 DNA During 2014
sa13155 Nonsense Available for shipment Available now
sa23105 Nonsense Mutation detected in F1 DNA During 2014
sa11300 Nonsense Available for shipment Available now
sa1881 Nonsense Available for shipment Available now
sa13319 Essential Splice Site Available for shipment Available now
sa14237 Nonsense Available for shipment Available now
sa18585 Nonsense Available for shipment Available now
sa23104 Nonsense Mutation detected in F1 DNA During 2014
sa2905 Nonsense F2 line generated During 2014
sa14514 Essential Splice Site Available for shipment Available now
sa25043 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 81 5236 1 72
ENSDART00000086201 Nonsense 81 5236 1 72
Genomic Location:
Chromosome 17 (position 29830507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCWCACCAGCGAGAGCSACGTGCGGGATTCCCGAAAGGAGTACTTTCTG[T/A]CAAGCTGSCCAGGTTCAGGAAGATCTCCTYACTTGCATCCAGAAGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 81 5236 1 72
ENSDART00000086201 Nonsense 81 5236 1 72
Genomic Location:
Chromosome 17 (position 29830507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCWCACCAGCGAGAGCCACGTGCGGGATTCCCGAAAGGAGTACTTTCTG[T/A]CAAGCTGSCCAGGTTCAGGAAGATCTCCTYACTTGCATCCAGAAGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 295 5236 4 72
Genomic Location:
Chromosome 17 (position 29794992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAAGGATGCAGGATTTTAGATTTTATCCGAAGACATTAACCAACAGG[T/C]AAGCATAAGGTCGTACAGCATTAACATCAGGCATAGCTTTAGAGTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 730 5236 11 72
Genomic Location:
Chromosome 17 (position 29757283)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGCAGCCAGATATTACCTGTCACCAGGACTCAGGTCAATGCCAGTGC[A/T]AGGCAAACGTAATCGGTACGTATCAAGCAGCATTGCGGCCTCCATCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 1034 5236 14 72
Genomic Location:
Chromosome 17 (position 29741123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTGATCCTGTGGGAGGATTCAATGGCACGTGTCACCCCCAAACAGGG[C/T]AGTGCTTGTGCAAGCCGTTTGTGACTGGGGATAAATGTGATGCCTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 2140 5236 32 72
Genomic Location:
Chromosome 17 (position 29664186)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NCCCTCTCTCTATCCAGACGTTGGTGTGTTCACTCCWCATAAGYTGCTGT[T/A]GAGTGCCTGTACTGAGGCAGGATGTACCAACAGTRCCCAGGTTACCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 2378 5236 36 72
Genomic Location:
Chromosome 17 (position 29647621)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACGAGCCAAGTGGGAGGCTCCCGCTGAACCCAACGGCAATCTAACCTA[C/A]ACAGTCCTCTTCGCAGGGCCAGGTAAATCAAACTTAACTGCTCCCCATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3256 5236 49 72
Genomic Location:
Chromosome 17 (position 29569538)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATAATATTACAACATATATKTATGCATGTGTTTTGTAGGAGAGRTCTG[T/A]TGTCTGGACTCTGTGGAGYAGCGTGTATCAGTGGGTCTCGGGGACTCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3263 5236 49 72
Genomic Location:
Chromosome 17 (position 29569519)
KASP Assay ID:
554-1871.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATGCATGTGTTTTGTAGGAGAGRTCTGTTGTCTGGACTCTGTGGAG[C/T]AGCGTGTATCAGTGGGTCTCGGGGACTCGTGTTGTGCTGGGCRTCCTTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 3548 5236 52 72
Genomic Location:
Chromosome 17 (position 29539182)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGAKGACATCATCCAGCTGGAATGGTCTGCCCCAATCAAACCCAATGG[T/C]AATGACCTCCAAATATATAATTACYTCCAAATATATRATTACCTCCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3824 5236 58 72
Genomic Location:
Chromosome 17 (position 29500079)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTTCTGTTTCCGTTTGCTTRTAGGTGTGTATAATTTAAGTTTCCCTT[T/A]GGAATATAACAYCCTGCTCAACGCAGGCACTGAGCGGCCACTCATTCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3826 5236 58 72
Genomic Location:
Chromosome 17 (position 29500072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCCGTTTGCTTRTAGGTGTGTATAATTTAAGTTTCCCTTWGGAATA[T/G]AACAYCCTGCTCAACGCAGGCACTGAGCGGCCACTCATTCGTTCTGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4183 5236 62 72
Genomic Location:
Chromosome 17 (position 29467720)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACCACAGAAGAGGCCATCCCATCCTCTCAACCAGCCCCCACAGTCTA[T/G]CAGGTACATTCCCGCAGTGTGGAGCTCTTCTGGTCTCCACCAGCCCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2905
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4646 5236 63 72
Genomic Location:
Chromosome 17 (position 29462786)
KASP Assay ID:
554-2793.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGCCTGTTCWCTGTTAGGCTGTGCTGCCAGTGACTGGTCTTCAAYA[C/T]AGACGCTTGAATCGCCCCCTGCTGGTCARCCTGCCCCATTGCTGGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 5012 5236 67 72
Genomic Location:
Chromosome 17 (position 29447478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGYGGCTTCCACAGYTTTCTACACATCCCACGCACCTCGGATAAAAG[T/A]ATGAACAMTGTGTGCCTCMGGCAGGACTCCATTTGACTCACAGGCYAGAS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 5206 5236 71 72
Genomic Location:
Chromosome 17 (position 29437965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTCAAGATAAGAAATCATGGGACGCAGACCTGCATGCCACTGACAGC[G/T]GAATGGTGAGATAAACCTGTGAAATTTCTGTCATAAGGGATATTATAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/94u2eghe