ush2a

Ensembl ID:
ENSDARG00000029482
ZFIN ID:
ZDB-GENE-060503-794
Description:
Novel protein similar to vertebrate Usher syndrome 2A (Autosomal recessive, mild) (USH2A) [Source:Un
Human Orthologue:
USH2A
Human Description:
Usher syndrome 2A (autosomal recessive, mild) [Source:HGNC Symbol;Acc:12601]
Mouse Orthologue:
Ush2a
Mouse Description:
Usher syndrome 2A (autosomal recessive, mild) homolog (human) Gene [Source:MGI Symbol;Acc:MGI:134129

Alleles

There are 22 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16626 Nonsense Available for shipment Available now
sa14011 Nonsense Available for shipment Available now
sa23107 Essential Splice Site Available for shipment Available now
sa36444 Nonsense Mutation detected in F1 DNA During 2016
sa23106 Nonsense Available for shipment Available now
sa36443 Nonsense Mutation detected in F1 DNA During 2016
sa39166 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13155 Nonsense Available for shipment Available now
sa23105 Nonsense Available for shipment Available now
sa11300 Nonsense Available for shipment Available now
sa1881 Nonsense Available for shipment Available now
sa39165 Nonsense Mutation detected in F1 DNA During 2016
sa13319 Essential Splice Site Available for shipment Available now
sa14237 Nonsense Available for shipment Available now
sa18585 Nonsense Available for shipment Available now
sa23104 Nonsense Available for shipment Available now
sa28877 Nonsense Mutation detected in F1 DNA During 2016
sa2905 Nonsense F2 line generated During 2016
sa36442 Nonsense Mutation detected in F1 DNA During 2016
sa42957 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14514 Essential Splice Site Available for shipment Available now
sa25043 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 81 5236 1 72
ENSDART00000086201 Nonsense 81 5236 1 72
Genomic Location (Zv9):
Chromosome 17 (position 29830507)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29754434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCWCACCAGCGAGAGCSACGTGCGGGATTCCCGAAAGGAGTACTTTCTG[T/A]CAAGCTGSCCAGGTTCAGGAAGATCTCCTYACTTGCATCCAGAAGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 81 5236 1 72
ENSDART00000086201 Nonsense 81 5236 1 72
Genomic Location (Zv9):
Chromosome 17 (position 29830507)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29754434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCWCACCAGCGAGAGCCACGTGCGGGATTCCCGAAAGGAGTACTTTCTG[T/A]CAAGCTGSCCAGGTTCAGGAAGATCTCCTYACTTGCATCCAGAAGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 295 5236 4 72
Genomic Location (Zv9):
Chromosome 17 (position 29794992)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29718919
KASP Assay ID:
2261-1203.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAAGGATGCAGGATTTTAGATTTTATCCGAAGACATTAACCAACAGG[T/C]AAGCATAAGGTCGTACAGCATTAACATCAGGCATAGCTTTAGAGTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 452 5236 6 72
Genomic Location (Zv9):
Chromosome 17 (position 29787082)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29711009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGGAGGATAACGGGGCTTTGGATCGTCCTGATTCTGTAAACTGTCTA[C/T]AGTTGCCCAGGTACTGTACACACACTGGCTTTGTATCTCGGTTAGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 730 5236 11 72
Genomic Location (Zv9):
Chromosome 17 (position 29757283)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29681210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGCAGCCAGATATTACCTGTCACCAGGACTCAGGTCAATGCCAGTGC[A/T]AGGCAAACGTAATCGGTACGTATCAAGCAGCATTGCGGCCTCCATCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 1671 5236 23 72
Genomic Location (Zv9):
Chromosome 17 (position 29688630)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29612557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCACCATCATCGGGCAGAACACTGGGGTCTTTATAGGAGGGATTCCA[G/T]AGAATTTCACTATTCTGAGACAAGACGCTGGTAAATCATCTCTGAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 2037 5236 29 72
Genomic Location (Zv9):
Chromosome 17 (position 29680338)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29604265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCGTCCCCCATCAGCGCCACCTTCCCCCACTCTCAGCACCTGACAGG[T/C]AAGGGCCGCGCAGTCCGCCTGGAGCTCGCCACTGACACCTTTTAACCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 2140 5236 32 72
Genomic Location (Zv9):
Chromosome 17 (position 29664186)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29588113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NCCCTCTCTCTATCCAGACGTTGGTGTGTTCACTCCWCATAAGYTGCTGT[T/A]GAGTGCCTGTACTGAGGCAGGATGTACCAACAGTRCCCAGGTTACCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 2378 5236 36 72
Genomic Location (Zv9):
Chromosome 17 (position 29647621)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29571548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACGAGCCAAGTGGGAGGCTCCCGCTGAACCCAACGGCAATCTAACCTA[C/A]ACAGTCCTCTTCGCAGGGCCAGGTAAATCAAACTTAACTGCTCCCCATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3256 5236 49 72
Genomic Location (Zv9):
Chromosome 17 (position 29569538)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29493465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATAATATTACAACATATATKTATGCATGTGTTTTGTAGGAGAGRTCTG[T/A]TGTCTGGACTCTGTGGAGYAGCGTGTATCAGTGGGTCTCGGGGACTCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3263 5236 49 72
Genomic Location (Zv9):
Chromosome 17 (position 29569519)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29493446
KASP Assay ID:
554-1871.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATGCATGTGTTTTGTAGGAGAGRTCTGTTGTCTGGACTCTGTGGAG[C/T]AGCGTGTATCAGTGGGTCTCGGGGACTCGTGTTGTGCTGGGCRTCCTTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3488 5236 52 72
Genomic Location (Zv9):
Chromosome 17 (position 29539362)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29463289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACTAGTTGTTTTTGTGACTGTGTTTCAGACACTGAGCTGGAGCCGTA[C/A]AGCAGTTATGAGTATAGGGTTGGTGTGTGGAACAGTTTTGGCCGTGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 3548 5236 52 72
Genomic Location (Zv9):
Chromosome 17 (position 29539182)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29463109
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGAKGACATCATCCAGCTGGAATGGTCTGCCCCAATCAAACCCAATGG[T/C]AATGACCTCCAAATATATAATTACYTCCAAATATATRATTACCTCCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3824 5236 58 72
Genomic Location (Zv9):
Chromosome 17 (position 29500079)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29424006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTTCTGTTTCCGTTTGCTTRTAGGTGTGTATAATTTAAGTTTCCCTT[T/A]GGAATATAACAYCCTGCTCAACGCAGGCACTGAGCGGCCACTCATTCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 3826 5236 58 72
Genomic Location (Zv9):
Chromosome 17 (position 29500072)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29423999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCCGTTTGCTTRTAGGTGTGTATAATTTAAGTTTCCCTTWGGAATA[T/G]AACAYCCTGCTCAACGCAGGCACTGAGCGGCCACTCATTCGTTCTGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4183 5236 62 72
Genomic Location (Zv9):
Chromosome 17 (position 29467720)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29391647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACCACAGAAGAGGCCATCCCATCCTCTCAACCAGCCCCCACAGTCTA[T/G]CAGGTACATTCCCGCAGTGTGGAGCTCTTCTGGTCTCCACCAGCCCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4346 5236 62 72
Genomic Location (Zv9):
Chromosome 17 (position 29467231)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29391158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTTGATTCGAGTGTGTTCAACTACACAGATGTGGATTTAAACGCATA[C/A]ACTCTCTACAGTTATGCAATCATTGCCTGTACCGTGGCAGGATGTGTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2905
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4646 5236 63 72
Genomic Location (Zv9):
Chromosome 17 (position 29462786)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29386713
KASP Assay ID:
554-2793.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGCCTGTTCWCTGTTAGGCTGTGCTGCCAGTGACTGGTCTTCAAYA[C/T]AGACGCTTGAATCGCCCCCTGCTGGTCARCCTGCCCCATTGCTGGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 4851 5236 65 72
Genomic Location (Zv9):
Chromosome 17 (position 29452026)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29375953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGAGGTCCCCTGAGTGAACTCCGCACCCAGGCCTCTGCCCCGGCACAG[C/T]AGCCCCCGCCACGACCCATCGCCCTCACTTCCCGCTCAGCTCTGGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 5011 5236 67 72
Genomic Location (Zv9):
Chromosome 17 (position 29447479)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29371406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGCGGCTTCCACAGTTTTCTACACATCCCACGCACCTCGGATAAAA[G/A]TATGAACACTGTGTGCCTCAGGCAGGACTCCATTTGACTCACAGGCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Essential Splice Site 5012 5236 67 72
Genomic Location (Zv9):
Chromosome 17 (position 29447478)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29371405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGYGGCTTCCACAGYTTTCTACACATCCCACGCACCTCGGATAAAAG[T/A]ATGAACAMTGTGTGCCTCMGGCAGGACTCCATTTGACTCACAGGCYAGAS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086201 Nonsense 5206 5236 71 72
Genomic Location (Zv9):
Chromosome 17 (position 29437965)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29361892
KASP Assay ID:
554-7749.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTCAAGATAAGAAATCATGGGACGCAGACCTGCATGCCACTGACAGC[G/T]GAATGGTGAGATAAACCTGTGAAATTTCTGTCATAAGGGATATTATAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link