ldlr

Ensembl ID:
ENSDARG00000029476
ZFIN ID:
ZDB-GENE-031217-1
Description:
low-density lipoprotein receptor [Source:RefSeq peptide;Acc:NP_001025454]
Human Orthologue:
LDLR
Human Description:
low density lipoprotein receptor [Source:HGNC Symbol;Acc:6547]
Mouse Orthologue:
Ldlr
Mouse Description:
low density lipoprotein receptor Gene [Source:MGI Symbol;Acc:MGI:96765]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33138 Nonsense Available for shipment Available now
sa16375 Nonsense Available for shipment Available now
sa38381 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046297 Nonsense 371 911 8 18
ENSDART00000146955 Nonsense 371 870 8 18
Genomic Location (Zv9):
Chromosome 3 (position 19133910)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19162272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAACCCAGACACCTGCAGCCAAATCTGTGTCAACCAGATGGGTAGTTA[T/G]AAGTGTGAGTGTGAGGATGGCTACCAGATGGACCCAGCCAGCAAGGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046297 Nonsense 657 911 14 18
ENSDART00000146955 Nonsense 697 870 14 18
Genomic Location (Zv9):
Chromosome 3 (position 19136226)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19164588
KASP Assay ID:
2259-3287.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACAGATTCTCACCCAAATACACATGTGCCTGTCCAGATAATATGATGT[T/A]GGCCAGAGATATGCGGAAATGTGTACCAGGCAAGTCAAATTTAGTAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046297 Nonsense 906 911 18 18
ENSDART00000146955 Nonsense 856 870 17 18
Genomic Location (Zv9):
Chromosome 3 (position 19143284)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19171646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACAGAGGACCAGGTGCATTTATGCAGAAACAACAGTTCTGATGGCTA[T/G]TTTTACCCTCAGGTATGATACTTTATTTTAAAGAAGTGCATAATATTAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link