si:ch211-278j12.1

Ensembl ID:
ENSDARG00000029472
ZFIN ID:
ZDB-GENE-050419-52
Description:
Novel protein similar to vertebrate myeloid/lymphoid or mixed-lineage leukemia (Trithorax homolog, D
Human Orthologue:
MLLT4
Human Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 [Sour
Mouse Orthologue:
Mllt4
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37140 Nonsense Available for shipment Available now
sa11340 Essential Splice Site Available for shipment Available now
sa11351 Essential Splice Site Available for shipment Available now
sa11362 Essential Splice Site Available for shipment Available now
sa37139 Nonsense Mutation detected in F1 DNA During 2017
sa37138 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039754 Nonsense 192 1813 4 33
ENSDART00000126343 Nonsense 226 1912 5 33
Genomic Location (Zv9):
Chromosome 20 (position 43275098)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43346257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAAGGACCATTTCTAACCCCGAGGTGGTGATGAAGAGAAGACGACAG[C/T]AGAAGCTGGAGAAGAGGATGCAGGAGTTTCGGAGTGAAGACGGTCGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039754 Essential Splice Site 471 1813 10 33
ENSDART00000126343 Essential Splice Site 505 1912 11 33
ENSDART00000039754 Essential Splice Site 471 1813 10 33
ENSDART00000126343 Essential Splice Site 505 1912 11 33
ENSDART00000039754 Essential Splice Site 471 1813 10 33
ENSDART00000126343 Essential Splice Site 505 1912 11 33
Genomic Location (Zv9):
Chromosome 20 (position 43258838)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43329997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCAAAAGAGACCCCGGGCCCATGATGAAAGGCAGGCACAARTCAGGG[T/G]GAGACATTTTTTTTTTTCTNNTCTTTTAATAGCAAAAGCCTCAAAAATCWCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039754 Essential Splice Site 471 1813 10 33
ENSDART00000126343 Essential Splice Site 505 1912 11 33
ENSDART00000039754 Essential Splice Site 471 1813 10 33
ENSDART00000126343 Essential Splice Site 505 1912 11 33
ENSDART00000039754 Essential Splice Site 471 1813 10 33
ENSDART00000126343 Essential Splice Site 505 1912 11 33
Genomic Location (Zv9):
Chromosome 20 (position 43258838)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43329997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCAAAAGAGACCCCGGGCCCATGATGAAAGGCAGGCACAARTCAGGG[T/G]GAGACATTTTTTTTTTTCTNNTCTTTTAATAGCAAAAGCCTCAAAAATCWCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039754 Essential Splice Site 471 1813 10 33
ENSDART00000126343 Essential Splice Site 505 1912 11 33
ENSDART00000039754 Essential Splice Site 471 1813 10 33
ENSDART00000126343 Essential Splice Site 505 1912 11 33
ENSDART00000039754 Essential Splice Site 471 1813 10 33
ENSDART00000126343 Essential Splice Site 505 1912 11 33
Genomic Location (Zv9):
Chromosome 20 (position 43258838)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43329997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCAAAAGAGACCCCGGGCCCATGATGAAAGGCAGGCACAARTCAGGG[T/G]GAGACATTTTTTTTTTTCTNNTCTTTTAATAGCAAAAGCCTCAAAAATCWCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039754 Nonsense 1016 1813 24 33
ENSDART00000126343 Nonsense 1050 1912 25 33
Genomic Location (Zv9):
Chromosome 20 (position 43192663)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43263822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTACTCTAAGATGTCTCTGTCTTGTAGAGCGGCAGAATTGATGACA[C/T]GAACTGGGTCTGTTGTAACGCTTGAGGTGGCCAAACAAGGAGCCATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039754 Essential Splice Site 1204 1813 27 33
ENSDART00000126343 Essential Splice Site 1238 1912 28 33
Genomic Location (Zv9):
Chromosome 20 (position 43183253)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43254412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCTTCCCCCTATGGATAACCACTCCAACAACAGCATGGTTATGCAGG[T/C]TAGCCTTTTTAGGAATTGAATGCATGGTATCCAGGGGCCACAGACAGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link