si:ch211-160i2.3

Ensembl ID:
ENSDARG00000029463
ZFIN ID:
ZDB-GENE-070912-129
Description:
hypothetical protein LOC100170829 [Source:RefSeq peptide;Acc:NP_001124135]
Human Orthologue:
ASAP1
Human Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 [Source:HGNC Symbol;Acc:2720]
Mouse Orthologue:
Asap1
Mouse Description:
ArfGAP with SH# domain, ankyrin repeat and PH domain1 Gene [Source:MGI Symbol;Acc:MGI:1342335]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19798 Essential Splice Site Available for shipment Available now
sa10661 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077151 Essential Splice Site 386 1077 13 27
ENSDART00000144870 Essential Splice Site 387 1132 13 28
Genomic Location (Zv9):
Chromosome 2 (position 32011965)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32310872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATCGAACATATCATTTCCAGGCAGAGGACGAACAGGAGTTTGTGATG[T/A]AAGTGTGAATGTGTGAGGTCGAGATCTTCATCTGTTATTTCCCTCATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077151 Essential Splice Site 1012 1077 25 27
ENSDART00000144870 Essential Splice Site 1067 1132 26 28
Genomic Location (Zv9):
Chromosome 2 (position 31988682)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32287589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGCCTTGGAAATGCCAGTCCCAATGCCACGCRAAATTAACACAGTA[G/C]TGAGTAAAAGACGTGTTTTATGGGTCAAAAATGGAACGTCATCAGTGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Multiple sclerosis: Genome-wide association study identifies new multiple sclerosis susceptibility loci on chromosomes 12 and 20. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link