cacna1sa

Ensembl ID:
ENSDARG00000029457
ZFIN ID:
ZDB-GENE-090514-1
Description:
calcium channel, voltage-dependent, L type, alpha 1S subunit, a [Source:RefSeq peptide;Acc:NP_00113
Human Orthologue:
CACNA1S
Human Description:
calcium channel, voltage-dependent, L type, alpha 1S subunit [Source:HGNC Symbol;Acc:1397]
Mouse Orthologue:
Cacna1s
Mouse Description:
calcium channel, voltage-dependent, L type, alpha 1S subunit Gene [Source:MGI Symbol;Acc:MGI:88294]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3185 Nonsense F2 line generated During 2014
sa5687 Nonsense F2 line generated During 2014
sa4977 Nonsense Mutation detected in F1 DNA During 2014
sa3205 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8800 Nonsense Mutation detected in F1 DNA During 2014
sa19275 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3185
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105895 Nonsense 179 1777 4 44
ENSDART00000134532 None None 1439 None 37
ENSDART00000105895 Nonsense 179 1777 4 44
ENSDART00000134532 None None 1439 None 37
Genomic Location:
Chromosome 22 (position 936613)
KASP Assay ID:
554-3158.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCGGTGGAGCAGAAGGGRGGATTCGACATGAAGGCGCTGCGAGCGTTC[A/T]GAGTGCTGCGGCCCCTGCGCCTCGTTTCCGGGGTCCCCAGTCAGTGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5687
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105895 Nonsense 179 1777 4 44
ENSDART00000134532 None None 1439 None 37
ENSDART00000105895 Nonsense 179 1777 4 44
ENSDART00000134532 None None 1439 None 37
Genomic Location:
Chromosome 22 (position 936613)
KASP Assay ID:
554-3158.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCGGTGGAGCAGAAGGGRGGATTCGACATGAAGGCGCTGCGAGCGTTC[A/T]GAGTGCTGCGGCCCCTGCGCCTCGTTTCCGGGGTCCCCAGTCAGTGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105895 Nonsense 414 1777 9 44
ENSDART00000134532 Nonsense 173 1439 4 37
Genomic Location:
Chromosome 22 (position 931144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCCTACAGGACGGATCTGAAACAGAGACCCTCTATGAGCTGGATATAT[T/A]GAACAAACTCATGTTTTATGTGTGAGTCAGCCTTTWCCCCACATTTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105895 Essential Splice Site 1216 1777 29 44
ENSDART00000134532 Essential Splice Site 975 1439 24 37
Genomic Location:
Chromosome 22 (position 909003)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGTSGATGTGTGTATTTATTCCTCTTTTCTGTACTTTCYTCTTCTCC[A/T]GGCGGCTCTCGCGGCTCAGGGCGGACTCTACTGCCTCACCGGCTGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105895 Nonsense 1649 1777 42 44
ENSDART00000134532 Nonsense 1408 1439 37 37
ENSDART00000105895 Nonsense 1649 1777 42 44
ENSDART00000134532 Nonsense 1408 1439 37 37
Genomic Location:
Chromosome 22 (position 899148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACCRGTTATCCCATGCCTACTCACAGGTGACCAGCCAGAGACCCCTA[C/T]AGCTCGCAGAYAGCAGARCGGAMAGGASGGAGACCACATACGCCAGTTAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105895 Nonsense 1649 1777 42 44
ENSDART00000134532 Nonsense 1408 1439 37 37
ENSDART00000105895 Nonsense 1649 1777 42 44
ENSDART00000134532 Nonsense 1408 1439 37 37
Genomic Location:
Chromosome 22 (position 899148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACCGGTTATCCCATGCCTACTCACAGGTGACCAGCCAGAGACCCCTA[C/T]AGCTCGCAGATAGCAGAGCGGACAGGACGGAGACCACATACGCCAGTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yvpymf2e