atp2a2a

Ensembl ID:
ENSDARG00000029439
ZFIN ID:
ZDB-GENE-040426-702
Description:
sarcoplasmic/endoplasmic reticulum calcium ATPase 2 [Source:RefSeq peptide;Acc:NP_957259]
Human Orthologue:
ATP2A2
Human Description:
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 [Source:HGNC Symbol;Acc:812]
Mouse Orthologue:
Atp2a2
Mouse Description:
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27138 Nonsense Mutation detected in F1 DNA During 2016
sa13962 Nonsense Available for shipment Available now
sa34332 Nonsense Mutation detected in F1 DNA During 2016
sa41137 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa27138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042040 Nonsense 364 996 9 22
ENSDART00000145436   None 55 None 6
ENSDART00000146241 Nonsense 364 1042 8 20
Genomic Location (Zv9):
Chromosome 8 (position 12235049)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11679812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGCTCCGACAAGACTGGCACCCTCACCACCAACCAGATGTCCGTCTG[C/A]AGGGTGAGTGAGTGAGTGAGTGAGTGCATCCTTTCTGCAGAAAGTTCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042040 Nonsense 407 996 11 22
ENSDART00000145436   None 55 None 6
ENSDART00000146241 Nonsense 407 1042 10 20
Genomic Location (Zv9):
Chromosome 8 (position 12241753)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11686516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGGTCWTTCAGATGCCTTGACAACAGAATCGTGAAGTGCTCCCARTA[T/A]GATGGTTTGGTGGAGYTGGCGACCATCTGTGCCTTRTGCAATGACTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042040 Nonsense 676 996 15 22
ENSDART00000145436   None 55 None 6
ENSDART00000146241 Nonsense 676 1042 14 20
Genomic Location (Zv9):
Chromosome 8 (position 12248537)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11693300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCGCCCCATGCCCAGCGTGAGGCGGTCACTGTGGCCCGCTGCTTCGCA[C/T]GAGTCGAGCCTTCACACAAGTCCAAGATTGTGGAGTTCCTGCAGGGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042040 Essential Splice Site 840 996 17 22
ENSDART00000145436   None 55 None 6
ENSDART00000146241 Essential Splice Site 840 1042 16 20
Genomic Location (Zv9):
Chromosome 8 (position 12251912)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11696675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCCCTCATCTCCGGATGGCTCTTTTTCAGATACTTGGCCATCGGCTG[T/C]GAGTTTCTGTACAAACATACATATGCTGATATTGAATAATTCATTATATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link