LOC557634

Ensembl ID:
ENSDARG00000029431
Human Orthologue:
PRR5L
Human Description:
proline rich 5 like [Source:HGNC Symbol;Acc:25878]
Mouse Orthologue:
Prr5l
Mouse Description:
proline rich 5 like Gene [Source:MGI Symbol;Acc:MGI:1919696]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13016 Nonsense Available for shipment Available now
sa1561 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046355 Nonsense 205 356 7 8
Genomic Location:
Chromosome 25 (position 31099799)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTTCATGCAGGGCATTCATGAGCCCAACGGACCAAYGCAAGAGTA[T/G]TTTCTACTGGAGAGACTAGTAGAGATGGTTATATCGCYTTACCTGAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046355 Nonsense 267 356 8 8
Genomic Location:
Chromosome 25 (position 31103611)
KASP Assay ID:
554-1504.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGACGCATTTTGCCCACGAGTCCTTCCTGGCACCTCTAATTGAACAC[G/T]AAGGTGAAGCCTATTTGGAAAGGACTGCCGGTGTGAGACGCCACACTGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tnj6db18