C7orf10 (1 of 2)

Ensembl ID:
ENSDARG00000029377
Description:
chromosome 7 open reading frame 10 [Source:HGNC Symbol;Acc:16001]
Human Orthologue:
C7orf10
Human Description:
chromosome 7 open reading frame 10 [Source:HGNC Symbol;Acc:16001]
Mouse Orthologue:
5033411D12Rik
Mouse Description:
RIKEN cDNA 5033411D12 gene Gene [Source:MGI Symbol;Acc:MGI:1923221]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15039 Nonsense Available for shipment Available now
sa5069 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048483 Nonsense 42 91 2 3
Genomic Location:
Chromosome 24 (position 2840533)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAAGCAGGAATGATTTGGCCGAAAACCCAAAGTACAAAAGCAACATGT[T/A]AAGAGTGAAGCACCGCAGAGAACTGCTGCAGATCCTGAGCAAGAGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048483 Nonsense 71 91 3 3
Genomic Location:
Chromosome 24 (position 2840925)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCCTCAGGTTCATTGAAGAAACGACTGGGGAATGGCTGCTGCGTTTC[G/T]AGGGCTCCGGYGTTCCCTGCGGTCCCATCAACAACATCCAGCAGGTGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/etd0d0r4