e2f4

Ensembl ID:
ENSDARG00000029358
ZFIN ID:
ZDB-GENE-040426-2773
Description:
transcription factor E2F4 [Source:RefSeq peptide;Acc:NP_998597]
Human Orthologue:
E2F4
Human Description:
E2F transcription factor 4, p107/p130-binding [Source:HGNC Symbol;Acc:3118]
Mouse Orthologue:
E2f4
Mouse Description:
E2F transcription factor 4 Gene [Source:MGI Symbol;Acc:MGI:103012]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44266 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018119 Nonsense 18 393 1 10
Genomic Location (Zv9):
Chromosome 25 (position 17762828)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17309198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGAGAGTCGCTGCAGCCGCAGACCCCCAGTCGCCACGAGAAAAGTCTC[G/T]GACTGCTCACCACCAAATTTGTGACTCTACTGCAGGAAGCGAAGGACGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link