serpine2

Ensembl ID:
ENSDARG00000029353
ZFIN ID:
ZDB-GENE-040426-848
Description:
glia-derived nexin [Source:RefSeq peptide;Acc:NP_956478]
Human Orthologue:
SERPINE2
Human Description:
serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 [Sourc
Mouse Orthologue:
Serpine2
Mouse Description:
serine (or cysteine) peptidase inhibitor, clade E, member 2 Gene [Source:MGI Symbol;Acc:MGI:101780]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6397 Essential Splice Site Mutation detected in F1 DNA During 2017
sa993 Nonsense Available for shipment Available now
sa42621 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041677 Essential Splice Site None 395 1 9
Genomic Location (Zv9):
Chromosome 15 (position 42130846)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43402904
KASP Assay ID:
554-4615.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGAGCTCTCCATCTGCCTGAATWAAGAAGTTGAGGTGCTTGGTACAGG[T/C]TAGTGGAGAATATTATATGATTTTTGCATCKTATTTGGTTCCWTATTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041677 Nonsense 122 395 3 9
Genomic Location (Zv9):
Chromosome 15 (position 42115420)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43387478
KASP Assay ID:
554-0897.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTGTGACCATCGCCAACGCWCTGTTCCCTAATGAGGGATTCAGCATG[A/T]AGGAGGACTTCCTGTCTGCCAACAGAGAGAACTTCCTGTGTGAGAGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041677 Nonsense 335 395 7 9
Genomic Location (Zv9):
Chromosome 15 (position 42095721)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43367779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTTTGGCATTTGTGTGTGAAACAGGTTCAGAGTCCATCTACGTGTCC[A/T]AAGCCCTTCAGAAAGCCAAGATAGAGGTCAATGAGGACGGAACCAAAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link