atxn7l3

Ensembl ID:
ENSDARG00000029331
ZFIN ID:
ZDB-GENE-030616-253
Description:
Ataxin-7-like protein 3 [Source:UniProtKB/Swiss-Prot;Acc:A1L209]
Human Orthologues:
ATXN7L3, ATXN7L3B
Human Descriptions:
ataxin 7-like 3 [Source:HGNC Symbol;Acc:25416]
ataxin 7-like 3B [Source:HGNC Symbol;Acc:37931]
Mouse Orthologues:
Atxn7l3, Atxn7l3b
Mouse Descriptions:
ataxin 7-like 3 Gene [Source:MGI Symbol;Acc:MGI:3036270]
ataxin 7-like 3B Gene [Source:MGI Symbol;Acc:MGI:1914971]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9492 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104118 Nonsense 33 367 3 13
Genomic Location:
Chromosome 3 (position 19927567)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGGCCTTGGCTCATGACGTGTACTCTGACCTAGTGGAAGATGCCTGTY[T/A]AGGGCTGTGCTTTGAGGTGCACAGGGCCGTCAAACAGGGCTATTTCTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rnjkj2o5