baiap2l1a

Ensembl ID:
ENSDARG00000029305
ZFIN ID:
ZDB-GENE-031201-1
Description:
BAI1-associated protein 2-like 1 [Source:RefSeq peptide;Acc:NP_944604]
Human Orthologue:
BAIAP2L1
Human Description:
BAI1-associated protein 2-like 1 [Source:HGNC Symbol;Acc:21649]
Mouse Orthologue:
Baiap2l1
Mouse Description:
BAI1-associated protein 2-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914148]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9204 Nonsense Mutation detected in F1 DNA During 2014
sa1476 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042006 Nonsense 17 161 1 6
Genomic Location:
Chromosome 12 (position 18891719)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGTCTCGAGCCTCGGAGGACGTGAACAAACTCACCGAGAGCACATAC[A/T]AGGTAAAGTCGCTTTAAACTGCGTGATGTGTTATTTTACAAYGTYCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042006 Nonsense 22 161 2 6
Genomic Location:
Chromosome 12 (position 18889697)
KASP Assay ID:
554-1401.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTTTAAAATATGAGCCTTGTTTCCTGTTCTTCCAGAATGTGATGGAA[C/T]AGTTCAACCCAGGACTGCGGAATCTGGTTAACCTGGGGAAGAACTATGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6t2gpxfc