LOC796115

Ensembl ID:
ENSDARG00000029296
Human Orthologue:
KIAA2022
Human Description:
KIAA2022 [Source:HGNC Symbol;Acc:29433]
Mouse Orthologue:
C77370
Mouse Description:
expressed sequence C77370 Gene [Source:MGI Symbol;Acc:MGI:2148050]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14178 Nonsense Available for shipment Available now
sa28271 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa14178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047816 Nonsense 210 1232 1 1
Genomic Location:
Chromosome 14 (position 11460177)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCCAGGACAAYATTAGGGAGAAAACCAATGTTCTGCAAGAAGAAACC[C/T]AGTTTAACTTTTTCCCAAGTGTCTTGGTAAACTGCACAAAGAAAGAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047816 Nonsense 1021 1232 1 1
Genomic Location:
Chromosome 14 (position 11462610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCCAAAGCTCCCAAGACAGACAAGGGAAAAATTCCACGTCAGAATTCA[C/T]GAACGTCTAAAAAGCTAAAGACTTTATTGGACGAGAAAGGCAGTAACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bvqs1ii0