LOC796115

Ensembl ID:
ENSDARG00000029296
Human Orthologue:
KIAA2022
Human Description:
KIAA2022 [Source:HGNC Symbol;Acc:29433]
Mouse Orthologue:
C77370
Mouse Description:
expressed sequence C77370 Gene [Source:MGI Symbol;Acc:MGI:2148050]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14178 Nonsense Available for shipment Available now
sa42356 Nonsense Mutation detected in F1 DNA During 2016
sa35647 Nonsense Mutation detected in F1 DNA During 2016
sa28271 Nonsense Mutation detected in F1 DNA During 2016
sa38983 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047816 Nonsense 210 1232 1 1
Genomic Location (Zv9):
Chromosome 14 (position 11460177)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10955534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCCAGGACAAYATTAGGGAGAAAACCAATGTTCTGCAAGAAGAAACC[C/T]AGTTTAACTTTTTCCCAAGTGTCTTGGTAAACTGCACAAAGAAAGAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047816 Nonsense 474 1232 1 1
Genomic Location (Zv9):
Chromosome 14 (position 11460969)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10956326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCAGTCCCCCCAAAAGGAAATATAAGCTAGCAAACAGGCTCAGAATT[C/T]AGAGAATTCAAACTGTGGAGCAATCACCCAACATGCAGGGCCCCTTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047816 Nonsense 738 1232 1 1
Genomic Location (Zv9):
Chromosome 14 (position 11461761)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10957118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTCCAACCAGCAGTTTACCACTGCAGATGTTGCTGAATCTGCGATT[C/T]AACCTAACAGCTTCGATGGAGAGATGGCTTTGCCTATGTCTGAGAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047816 Nonsense 1021 1232 1 1
Genomic Location (Zv9):
Chromosome 14 (position 11462610)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10957967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCCAAAGCTCCCAAGACAGACAAGGGAAAAATTCCACGTCAGAATTCA[C/T]GAACGTCTAAAAAGCTAAAGACTTTATTGGACGAGAAAGGCAGTAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047816 Nonsense 1154 1232 1 1
Genomic Location (Zv9):
Chromosome 14 (position 11463009)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10958366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAGTACAGGGGGCACAAAAGGCAGAAAAGGTGGGACGAAAAGTGTC[A/T]AAAATCAGCCAAAGTTCAATGCCTCCTTACCTTTTTTCCCTCAGCTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link