hoxb3a

Ensembl ID:
ENSDARG00000029263
ZFIN ID:
ZDB-GENE-990415-104
Description:
Homeobox protein Hox-B3a [Source:UniProtKB/Swiss-Prot;Acc:O42368]
Human Orthologue:
HOXB3
Human Description:
homeobox B3 [Source:HGNC Symbol;Acc:5114]
Mouse Orthologue:
Hoxb3
Mouse Description:
homeobox B3 Gene [Source:MGI Symbol;Acc:MGI:96184]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17382 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078466 Essential Splice Site None 417 None 5
ENSDART00000131410 Essential Splice Site None 113 None 3
ENSDART00000143981 Essential Splice Site None 92 None 3
Genomic Location:
Chromosome 3 (position 24037266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGGATTTACCTCGTGCCCCTCTTATTATGTGCCTCTTATAACCTTTC[A/T]GGTCAGCTTCCAAGAGGCCATTGGAAAGAGACCGTCACGTGACAACTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4m8nbsql