fubp1

Ensembl ID:
ENSDARG00000029248
ZFIN ID:
ZDB-GENE-040426-2159
Description:
far upstream element-binding protein 1 [Source:RefSeq peptide;Acc:NP_998309]
Human Orthologue:
FUBP1
Human Description:
far upstream element (FUSE) binding protein 1 [Source:HGNC Symbol;Acc:4004]
Mouse Orthologue:
Fubp1
Mouse Description:
far upstream element (FUSE) binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1196294]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32842 Nonsense Mutation detected in F1 DNA During 2016
sa19676 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081442 Nonsense 294 642 11 19
ENSDART00000128153 Nonsense 294 642 11 20
Genomic Location (Zv9):
Chromosome 2 (position 8438884)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8856538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTGTGGGTATTGTGATTGGCCGGAGTGGCGAAATGATCAAGAAGATT[C/T]AGAATGATACTGGTGTGAGGATTCAGTTCAAACCAGGTATAAGAGGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081442 Essential Splice Site 392 642 12 19
ENSDART00000128153 Essential Splice Site 392 642 12 20
Genomic Location (Zv9):
Chromosome 2 (position 8439605)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8857259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTACTTTTACTGTACCTACCATGAAGACTGGCCTCATTATTGGCAAAG[G/A]TTAGTTGTTGTCACATTACACTAATACATTCCATCAGGGAGATATGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link