fubp1

Ensembl ID:
ENSDARG00000029248
ZFIN ID:
ZDB-GENE-040426-2159
Description:
far upstream element-binding protein 1 [Source:RefSeq peptide;Acc:NP_998309]
Human Orthologue:
FUBP1
Human Description:
far upstream element (FUSE) binding protein 1 [Source:HGNC Symbol;Acc:4004]
Mouse Orthologue:
Fubp1
Mouse Description:
far upstream element (FUSE) binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1196294]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19676 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081442 Essential Splice Site 392 642 12 19
ENSDART00000128153 Essential Splice Site 392 642 12 20
Genomic Location:
Chromosome 2 (position 8439605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTACTTTTACTGTACCTACCATGAAGACTGGCCTCATTATTGGCAAAG[G/A]TTAGTTGTTGTCACATTACACTAATACATTCCATCAGGGAGATATGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2wato0w6