fbxo3

Ensembl ID:
ENSDARG00000029242
ZFIN ID:
ZDB-GENE-050522-269
Description:
F-box only protein 3 [Source:RefSeq peptide;Acc:NP_001018538]
Human Orthologue:
FBXO3
Human Description:
F-box protein 3 [Source:HGNC Symbol;Acc:13582]
Mouse Orthologue:
Fbxo3
Mouse Description:
F-box protein 3 Gene [Source:MGI Symbol;Acc:MGI:1929084]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21023 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139382 Essential Splice Site 31 451 None 11

The following transcripts of ENSDARG00000029242 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 40106553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCCTTACTTCTGGTGCTGTCATTCCTGGACTTCCGAGATCTTATCAGG[T/C]AGACATTACACTCGAGCCATACCGTTAGTCCGTGCAACAGCAAGCACGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/stmkaxa6