cep55l

Ensembl ID:
ENSDARG00000029241
ZFIN ID:
ZDB-GENE-050522-222
Description:
centrosomal protein of 55 kDa [Source:RefSeq peptide;Acc:NP_001018598]
Human Orthologue:
CEP55
Human Description:
centrosomal protein 55kDa [Source:HGNC Symbol;Acc:1161]
Mouse Orthologue:
Cep55
Mouse Description:
centrosomal protein 55 Gene [Source:MGI Symbol;Acc:MGI:1921357]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
e48 Nonsense Confirmed mutation in F2 line Unknown
sa22018 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
e48
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048256 Nonsense 39 435 2 9
ENSDART00000106517 Nonsense 39 435 2 11
Genomic Location:
Chromosome 12 (position 5754911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAAAGTCAGCAGAGCTGGAGGTGGAGAAGCTGAAGAGAGAGAACCAG[C/T]AGATGAAGAAAAGCCTGGAGGACATGAAGAGAGCTGGGAGACATCAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048256 Nonsense 342 435 8 9
ENSDART00000106517 Nonsense 342 435 8 11
Genomic Location:
Chromosome 12 (position 5745771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCTGTCTGCTAAAGAATCAGAAAATGAAAAACTAGACCGTCAAACTT[T/A]ACAGCATCAACTGCATAAAGTTTTGAAGGAGCTCCGGAAGGCCAGAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/axunduz3