pnp4b

Ensembl ID:
ENSDARG00000029230
ZFIN ID:
ZDB-GENE-040426-1887
Description:
purine nucleoside phosphorylase 4b [Source:RefSeq peptide;Acc:NP_991206]
Human Orthologue:
PNP
Human Description:
purine nucleoside phosphorylase [Source:HGNC Symbol;Acc:7892]
Mouse Orthologues:
Pnp, Pnp2
Mouse Descriptions:
purine-nucleoside phosphorylase 2 Gene [Source:MGI Symbol;Acc:MGI:3712328]
purine-nucleoside phosphorylase Gene [Source:MGI Symbol;Acc:MGI:97365]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22903 Nonsense Available for shipment Available now
sa22902 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041993 Nonsense 16 304 2 6
ENSDART00000139588 Nonsense 16 210 2 5
ENSDART00000141275 Nonsense 16 225 2 5

The following transcripts of ENSDARG00000029230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 38237971)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36878454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATGATGGTTTATTTCTTTAAATTAGCTGCTGCTCGTTTGATGACTGC[A/T]AACTGACCACAGAATGGCTGCTGAGCAGGACAAGACACAGGCCGAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041993 Nonsense 197 304 5 6
ENSDART00000139588 Nonsense 103 210 4 5
ENSDART00000141275 Nonsense 197 225 5 5

The following transcripts of ENSDARG00000029230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 38219927)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 36860410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATCACTGCAGAGCTGGGCTACTCCAACTTTGTGCATGAGGGCGTTTA[C/A]TGTATGGTCAGTGGACCCAACTTTGAAACCATTGCTGAGGCACGCATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link