A9JSV0_DANRE

Ensembl ID:
ENSDARG00000029204
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JSV0]
Human Orthologue:
TYRP1
Human Description:
tyrosinase-related protein 1 [Source:HGNC Symbol;Acc:12450]
Mouse Orthologue:
Tyrp1
Mouse Description:
tyrosinase-related protein 1 Gene [Source:MGI Symbol;Acc:MGI:98881]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27116 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa27116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050528 Nonsense 48 584 2 9
Genomic Location (Zv9):
Chromosome 7 (position 77093257)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 73941515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGCTCTGCTCTGTGTGCGGGCTCTGCAGACTGGGTTTACTGGACTT[T/A]ACTGGGATTTTACTCACTTATTTCTAGATTTCCTGCGATGTTTGGACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link