ano7

Ensembl ID:
ENSDARG00000029189
Human Orthologue:
ANO7
Human Description:
anoctamin 7 [Source:HGNC Symbol;Acc:31677]
Mouse Orthologue:
Ano7
Mouse Description:
anoctamin 7 Gene [Source:MGI Symbol;Acc:MGI:3052714]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12503 Essential Splice Site Available for shipment Available now
sa9119 Nonsense Mutation detected in F1 DNA During 2014
sa22580 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15317 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045474 Essential Splice Site 323 883 9 23
Genomic Location:
Chromosome 15 (position 4006072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTATATTTCTGTTTGGTATCTGGCTGATGGTCACTGATGTGCCAGCG[T/A]AAGTATYATCACAGGCTTGCMAATAATGGCATAATATTGATGACCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045474 Nonsense 435 883 12 23
Genomic Location:
Chromosome 15 (position 4005416)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGTAATCCWGTGACTGGGGCTGAGGAGCCTTATTTCCCAGAGGCCCGT[C/T]GACTGAGYCGTACTCTAACCGGCAACATRGTCATCATTCTAATGGTAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045474 Essential Splice Site 449 883 12 23
Genomic Location:
Chromosome 15 (position 4005370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCGACTGAGTCGTACTCTAACCGGCAACATGGTCATCATTCTAATGG[T/G]AGGTCCACTCCATTTTTTTCAATCTATAATGATTGAACTCCACAGATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045474 Essential Splice Site 605 883 17 23
Genomic Location:
Chromosome 15 (position 4002270)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATGGTRGGCAAGCARGTCATCAGCAACATCCAGGAATTTGTATTACC[G/A]TAAGTCTGTATGCTCACTGCATCTTCTTACAGGTTTTGTTTATACAATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ycpq1msb