ano7

Ensembl ID:
ENSDARG00000029189
Human Orthologue:
ANO7
Human Description:
anoctamin 7 [Source:HGNC Symbol;Acc:31677]
Mouse Orthologue:
Ano7
Mouse Description:
anoctamin 7 Gene [Source:MGI Symbol;Acc:MGI:3052714]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12503 Essential Splice Site Available for shipment Available now
sa35794 Nonsense Mutation detected in F1 DNA During 2016
sa9119 Nonsense Mutation detected in F1 DNA During 2016
sa22580 Essential Splice Site Available for shipment Available now
sa15317 Essential Splice Site Available for shipment Available now
sa35793 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045474 Essential Splice Site 323 883 9 23
Genomic Location (Zv9):
Chromosome 15 (position 4006072)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3941624
KASP Assay ID:
2260-8091.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTATATTTCTGTTTGGTATCTGGCTGATGGTCACTGATGTGCCAGCG[T/A]AAGTATYATCACAGGCTTGCMAATAATGGCATAATATTGATGACCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045474 Nonsense 336 883 10 23
Genomic Location (Zv9):
Chromosome 15 (position 4005940)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3941492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTCCACAGGGAAGAGTTGTGCTCCAGTGGAAATGCCTTCATCATGTG[T/A]CCACTATGCAACATCTGCAGCCACTGGAACCTCTCGAGTATCTGCTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045474 Nonsense 435 883 12 23
Genomic Location (Zv9):
Chromosome 15 (position 4005416)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3940968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGTAATCCWGTGACTGGGGCTGAGGAGCCTTATTTCCCAGAGGCCCGT[C/T]GACTGAGYCGTACTCTAACCGGCAACATRGTCATCATTCTAATGGTAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045474 Essential Splice Site 449 883 12 23
Genomic Location (Zv9):
Chromosome 15 (position 4005370)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3940922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCGACTGAGTCGTACTCTAACCGGCAACATGGTCATCATTCTAATGG[T/G]AGGTCCACTCCATTTTTTTCAATCTATAATGATTGAACTCCACAGATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045474 Essential Splice Site 605 883 17 23
Genomic Location (Zv9):
Chromosome 15 (position 4002270)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3937822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATGGTRGGCAAGCARGTCATCAGCAACATCCAGGAATTTGTATTACC[G/A]TAAGTCTGTATGCTCACTGCATCTTCTTACAGGTTTTGTTTATACAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045474 Nonsense 854 883 23 23
Genomic Location (Zv9):
Chromosome 15 (position 3991071)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3926623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTTTCTTTAGTCGTTGAGTAAATCTGTCCTGGAAGAGATGGGGAGG[C/T]AAAACTTTGAGCTGCGGCAAAGGATAAGAACACAGAGTCCAACAAACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link