exosc3

Ensembl ID:
ENSDARG00000029187
ZFIN ID:
ZDB-GENE-050706-140
Description:
exosome complex exonuclease RRP40 [Source:RefSeq peptide;Acc:NP_001025132]
Human Orthologue:
EXOSC3
Human Description:
exosome component 3 [Source:HGNC Symbol;Acc:17944]
Mouse Orthologue:
Exosc3
Mouse Description:
exosome component 3 Gene [Source:MGI Symbol;Acc:MGI:1913612]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7749 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046840 Nonsense 66 247 1 4

The following transcripts of ENSDARG00000029187 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 53499059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCGGAGCGGAGATCCGTGTGTGTAGAGCRGGAGTCCTGAAACACAAA[C/T]AACCCAACATGTACTGGGTCAACTGTCAGCAGAGACGGGTCAGANNNNNNACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eynjhmpp