lnx2a

Ensembl ID:
ENSDARG00000029177
ZFIN ID:
ZDB-GENE-060228-2
Description:
ligand of numb-protein X 2a [Source:RefSeq peptide;Acc:NP_001106696]
Human Orthologue:
LNX2
Human Description:
ligand of numb-protein X 2 [Source:HGNC Symbol;Acc:20421]
Mouse Orthologue:
Lnx2
Mouse Description:
ligand of numb-protein X 2 Gene [Source:MGI Symbol;Acc:MGI:2155959]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24497 Nonsense Mutation detected in F1 DNA During 2014
sa24496 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046211 Nonsense 113 737 2 11
ENSDART00000123216 Nonsense 113 705 2 11
Genomic Location:
Chromosome 24 (position 22279101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTCCAGCATTCTGGTGCACAAGCTGCTGGACAAGTTGTCGGTCACCTG[T/A]CCGCTCACGCCCTCCTGCTCGCTCAGCATGCCTCGCTGCGACCTGGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046211 Essential Splice Site 256 737 None 11
ENSDART00000123216 Essential Splice Site 224 705 None 11
Genomic Location:
Chromosome 24 (position 22267686)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCAGGATGGGACTTTGTTGAAACTCTTCCTCTTTCTGCTGAAGAAGG[T/C]ATCATTTCATCCTGCTCTACACTACACCTCTTTCTATAGGATGAAATGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y4djygpt