polr1a

Ensembl ID:
ENSDARG00000029172
ZFIN ID:
ZDB-GENE-030131-5286
Description:
DNA-directed RNA polymerase [Source:UniProtKB/TrEMBL;Acc:Q7SXQ2]
Human Orthologue:
POLR1A
Human Description:
polymerase (RNA) I polypeptide A, 194kDa [Source:HGNC Symbol;Acc:17264]
Mouse Orthologue:
Polr1a
Mouse Description:
polymerase (RNA) I polypeptide A Gene [Source:MGI Symbol;Acc:MGI:1096397]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12570 Nonsense Available for shipment Available now
sa2745 Essential Splice Site F2 line generated During 2014
sa4556 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa22458 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22459 Nonsense Mutation detected in F1 DNA During 2014
sa1376 Nonsense Available for shipment Available now
sa22460 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044708 Nonsense 112 810 3 17
ENSDART00000114501 Nonsense 112 1710 3 36
ENSDART00000123326 Nonsense 112 1684 3 34
Genomic Location:
Chromosome 14 (position 20098106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATATTTACTCATCCGGGGTTCATGCCTGTCATGTCACATACTGAAGTG[T/A]CCAAGAGCAGCTATTCAYTTACTGCTGTGCCAGCTGAAGCTCCTGGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2745
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044708 Essential Splice Site 264 810 7 17
ENSDART00000114501 Essential Splice Site 276 1710 8 36
ENSDART00000123326 Essential Splice Site 264 1684 7 34
Genomic Location:
Chromosome 14 (position 20102256)
KASP Assay ID:
554-2769.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCCGAGTGTGGCACGAGAACACATCATCAAACTTTGGGAGACAGAAG[G/A]TAGGATTGATTGAGTTTATTTATCATTTCTTTTTGGTTTTACAGTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044708 Splice Site, Nonsense 354 810 9 17
ENSDART00000114501 Splice Site, Nonsense 366 1710 10 36
ENSDART00000123326 Splice Site, Nonsense 345 1684 9 34
Genomic Location:
Chromosome 14 (position 20103711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTGATGAGAAAACCAAGGCTATTGAAGGCACACAGACAGAGCTGGAG[C/T]AGGTAAGAAGAACAATACAATAATACAATACAAAACAATATTTATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044708 Essential Splice Site 530 810 12 17
ENSDART00000114501 Essential Splice Site 542 1710 13 36
ENSDART00000123326 Essential Splice Site 521 1684 12 34
Genomic Location:
Chromosome 14 (position 20110197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACTCCTGACACCCAGCACTGGCCAGCACAGGATACCCATGAAAATTG[T/A]GAGTCGGTTATCTTTGACAGAAACACACTGTTTTTGACATACATTTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044708 Nonsense 781 810 16 17
ENSDART00000114501 Nonsense 793 1710 17 36
ENSDART00000123326 Nonsense 772 1684 16 34
Genomic Location:
Chromosome 14 (position 20115244)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACTAGTGGGAAACTGCTTAGCTGTCTGGCACGGCTCTTCACTGCCTA[T/A]CTGCAGCTTTACCGCGGGTTTACTTTGGGTAAATCCACATCGATGCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044708 None None 810 None 17
ENSDART00000114501 Nonsense 1487 1710 32 36
ENSDART00000123326 Nonsense 1461 1684 30 34
Genomic Location:
Chromosome 14 (position 20133691)
KASP Assay ID:
554-1288.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTGAGAGCCAACAGAGAGTTAACTCTGAACAGCCGAAGGGAAGCTCA[C/T]AGGGCTCAGTGAGGATCAACTCTGTGCTGCAGTTAAGCGCTGCTATTGAG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 48 hpf

Control on top; Mutant below; 48 hpf

zoom

Control; 48 hpf

Control; 48 hpf

zoom

Mutant; 48 hpf

Mutant; 48 hpf

zoom

Stage Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
blood
ZFA:0000007
quality
PATO:0000001
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
brain
ZFA:0000008
quality
PATO:0000001
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
extension
ZFA:0000106
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
hindbrain
ZFA:0000029
hydrocephalic
PATO:0001853
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
melanocyte
ZFA:0009091
quality
PATO:0000001
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
15:34387401-34388990 34388990 1 2.04 × 10-86 2.9 0 sesn3 ENSDARG00000015822
25:34827000-34827300 34827000 -1 1.49 × 10-70 3.1 2 rps27.2 ENSDARG00000090186
4:22069901-22070954 22070954 1 1.76 × 10-66 3.4 15 mdm2 ENSDARG00000033443
25:24248137-24248600 24248137 -1 1.20 × 10-64 2.2 0 phlda2 ENSDARG00000042874
6:12968101-12968650 12968650 1 6.06 × 10-60 3.6 4 casp8 ENSDARG00000058325

Mutation Details

Allele Name:
sa22460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044708 None None 810 None 17
ENSDART00000114501 Nonsense 1537 1710 33 36
ENSDART00000123326 Nonsense 1511 1684 31 34
Genomic Location:
Chromosome 14 (position 20137672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGCCGATCACTAAAGTGCACTTTGACCTCACCTCAGTGGTGGTGAAA[C/T]AGGCTCAGAACGCGGTCATCATGGAGACCAAGGGCATCACGCGCTGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gy9uiwjc