si:ch211-200p22.4

Ensembl ID:
ENSDARG00000029170
ZFIN ID:
ZDB-GENE-081104-61
Description:
Novel protein similar to phosphatidylinositol binding clathrin assembly protein (Picalm) [Source:Uni

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14566 Nonsense Available for shipment Available now
sa26944 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028566 Nonsense 622 648 22 22
ENSDART00000146104 Nonsense 561 587 17 18

The following transcripts of ENSDARG00000029170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 24926205)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23487957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTCCTCCTCAGCTGGGACAGATGGGAGGGGTTCCAGTCATGACCCAA[C/T]AACCCATGTTGTACAACCAGCCWGTTCTCAGACCCACTAACCCTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028566 Missense 645 648 22 22
ENSDART00000146104 Essential Splice Site 583 587 None 18

The following transcripts of ENSDARG00000029170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 24926135)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23487887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGTTCTCAGACCCACTAACCCTTTCACACCCATCCCTGGAGCCCAGG[T/C]ACTCATACAAACACACACCACCTGTGTCACACTCAAATACACTATGCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link