ppfibp2b

Ensembl ID:
ENSDARG00000029168
ZFIN ID:
ZDB-GENE-040718-54
Description:
protein tyrosine phosphatase, receptor-type, F interacting protein, binding protein 2b [Source:RefS
Human Orthologue:
PPFIBP2
Human Description:
PTPRF interacting protein, binding protein 2 (liprin beta 2) [Source:HGNC Symbol;Acc:9250]
Mouse Orthologue:
Ppfibp2
Mouse Description:
PTPRF interacting protein, binding protein 2 (liprin beta 2) Gene [Source:MGI Symbol;Acc:MGI:894649]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24627 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089035 Essential Splice Site 469 986 13 27
ENSDART00000126641   None 243 None 6
ENSDART00000140047   None 118 None 3
ENSDART00000144723 Essential Splice Site 376 822 11 21
Genomic Location (Zv9):
Chromosome 25 (position 16377851)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15924395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTGTCCAGCAGTTTGGAGGAGCTCCAGAGCGGCAGCTTGCAGATGG[T/A]ATTGAAATCTCAGGCATTTTGTGACTCTTCTGCTTCTTGCGGCCAACTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link