med23

Ensembl ID:
ENSDARG00000029157
ZFIN ID:
ZDB-GENE-040724-82
Description:
Mediator of RNA polymerase II transcription subunit 23 [Source:UniProtKB/Swiss-Prot;Acc:Q5RIW8]
Human Orthologue:
MED23
Human Description:
mediator complex subunit 23 [Source:HGNC Symbol;Acc:2372]
Mouse Orthologue:
Med23
Mouse Description:
mediator complex subunit 23 Gene [Source:MGI Symbol;Acc:MGI:1917458]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36943 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14434 Essential Splice Site Available for shipment Available now
sa23624 Nonsense Available for shipment Available now
sa36942 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17366 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028115 Essential Splice Site 175 1352 7 29
ENSDART00000135760 Essential Splice Site 199 1376 7 29
ENSDART00000141595 Essential Splice Site 210 1387 7 29
Genomic Location (Zv9):
Chromosome 20 (position 2600665)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2554849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGACTGAGATCCGGAAACTTTGTCCAGAGGGGGCGCTCTCACACTGGG[T/C]AACAAACATACGCATGTTCACACTCGTGGAGATTCCCCTTTCAGCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028115 Essential Splice Site 236 1352 9 29
ENSDART00000135760 Essential Splice Site 260 1376 9 29
ENSDART00000141595 Essential Splice Site 271 1387 9 29
Genomic Location (Zv9):
Chromosome 20 (position 2599006)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2553190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCSACCACTCTGCGTTTCCCTCTGAGAGGAATGCTGCCGTATGATAAGG[T/C]ACYGCTTTGCGCCTCATGAATCTTACATATTAAAGTGCAYAGGTCACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028115 Nonsense 476 1352 14 29
ENSDART00000135760 Nonsense 500 1376 14 29
ENSDART00000141595 Nonsense 511 1387 14 29
Genomic Location (Zv9):
Chromosome 20 (position 2580378)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2534562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCCGAGTGCTTCACGCTGCCCATGGGCGTCCTGGTGGAGACCATCTA[C/A]GGCAATGGTAGCATGCGCATCACTCTGCCAGGCACCAATTGCATGGCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028115 Essential Splice Site 514 1352 14 29
ENSDART00000135760 Essential Splice Site 538 1376 14 29
ENSDART00000141595 Essential Splice Site 549 1387 14 29
Genomic Location (Zv9):
Chromosome 20 (position 2580263)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2534447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGCCCATGAACCTGCTGGACTCCCTAACCGTCCATGCTAAGATGAGG[T/C]AAGACTGATCAAAAACTAGCCTAGAGCGCTGTCTGTTGTTAAAACTAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028115 Nonsense 904 1352 22 29
ENSDART00000135760 Nonsense 928 1376 22 29
ENSDART00000141595 Nonsense 939 1387 22 29
Genomic Location (Zv9):
Chromosome 20 (position 2548525)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2502709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGTTGAYATCASTAATGATCYCCTCGACTGTGCCSCRTGCAGAAGTA[T/A]CCAGAGAAGCTGTATTTYGAGGGTCTGGCGGAGCAGGTCAATYCTCCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link