hsp90ab1

Ensembl ID:
ENSDARG00000029150
ZFIN ID:
ZDB-GENE-990415-95
Description:
Heat shock protein HSP 90-beta [Source:UniProtKB/Swiss-Prot;Acc:O57521]
Human Orthologues:
HSP90AB1, HSP90AB4P
Human Descriptions:
heat shock protein 90kDa alpha (cytosolic), class B member 1 [Source:HGNC Symbol;Acc:5258]
heat shock protein 90kDa alpha (cytosolic), class B member 4 (pseudogene) [Source:HGNC Symbol;Acc:32
Mouse Orthologue:
Hsp90ab1
Mouse Description:
heat shock protein 90 alpha (cytosolic), class B member 1 Gene [Source:MGI Symbol;Acc:MGI:96247]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12875 Essential Splice Site Available for shipment Available now
sa10 Essential Splice Site Confirmed mutation in F2 line During 2014
sa15412 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020084 Essential Splice Site 49 725 None 12
ENSDART00000129014 Essential Splice Site 49 710 None 12

The following transcripts of ENSDARG00000029150 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 51534611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAKGRTTAATTGATRCATCDGCAAAATRTTCCCATTKCTCNNTTTTAAT[A/T]GGCTCTTGACAAAATCAGATATGAAAGYTTGACAGATCCCACCAAACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020084 Essential Splice Site 318 725 6 12
ENSDART00000129014 Essential Splice Site 303 710 6 12

The following transcripts of ENSDARG00000029150 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 51537521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTACAAGAGCCTGACCAACGACTGGGAAGACCACCTGGCTGTCAAGG[T/C]AATAGGAGCTCTACTAAGTGGGATGTAATGTATTAGGGATGTAATGAACT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020084 Nonsense 471 725 9 12
ENSDART00000129014 Nonsense 456 710 9 12

The following transcripts of ENSDARG00000029150 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 51540752)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTACCAGAGCTCRCAGTCCGGCGACGAGATGASCTCCCTCACAGAATA[C/A]GTCAGCCGTATGAAGGAGAACCAAAAGTCCATCTATTACATCACTGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x56smrgq