si:ch73-60e21.3

Ensembl ID:
ENSDARG00000029146
ZFIN ID:
ZDB-GENE-030131-7126
Description:
LOC565797 protein [Source:UniProtKB/TrEMBL;Acc:A5PLF1]
Human Orthologue:
LRP1
Human Description:
low density lipoprotein receptor-related protein 1 [Source:HGNC Symbol;Acc:6692]
Mouse Orthologue:
Lrp1
Mouse Description:
low density lipoprotein receptor-related protein 1 Gene [Source:MGI Symbol;Acc:MGI:96828]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa166 Nonsense Confirmed mutation in F2 line During 2017
sa200 Nonsense Confirmed mutation in F2 line During 2017
sa30741 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37718 Nonsense Mutation detected in F1 DNA During 2017
sa24342 Nonsense Available for shipment Available now
sa24341 Nonsense Available for shipment Available now
sa12511 Nonsense Available for shipment Available now
sa14527 Essential Splice Site Available for shipment Available now
sa37717 Nonsense Mutation detected in F1 DNA During 2017
sa43990 Nonsense Mutation detected in F1 DNA During 2017
sa18116 Essential Splice Site Available for shipment Available now
sa37716 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa166
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 296 4549 7 89
Genomic Location (Zv9):
Chromosome 23 (position 25854410)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25640530
KASP Assay ID:
554-0144.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTTCTCTTTCTTTGTCTTCTAGATATGGAGCAGATGGCCATTGACTG[G/A]TTGACCGGAAACTTCTACTTTGTGGATAATGTGGATGACCGCATATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa200
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 441 4549 9 89
Genomic Location (Zv9):
Chromosome 23 (position 25850770)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25636890
KASP Assay ID:
554-0150.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTTTGAGAACTATCTGTATGCCACCAACTCTGACAACGCCAACATG[C/T]AACCCAAAACCAGCGTCATCAGAGTCAACCGATTCAACAGCTCTGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Essential Splice Site 528 4549 10 89
Genomic Location (Zv9):
Chromosome 23 (position 25849888)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25636008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGCCGCTCTGGCTTTAGCCTTGGCAGTGATGGAAAGTCCTGCAAGAG[T/C]GAGTAAAATGTCATTCTGTCCACCCTCAATTAGTTCCAAACACCATAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 530 4549 11 89
Genomic Location (Zv9):
Chromosome 23 (position 25848297)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25634417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATTTTATTTTTCCATTTATACTTTGTTATATATCCTATACAGAACCA[G/T]AGCATGAGCTGTTCCTGATCTATGGTAAAGGCCGGCCTGGAGTCATCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 1072 4549 21 89
Genomic Location (Zv9):
Chromosome 23 (position 25829593)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25615713
KASP Assay ID:
2261-7817.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTGCAGCCACGCGGCCTCCCGGCGGTTGCCACACGGATGAGTTC[C/T]AATGCCGGATGGATGGTTTGTGTATTCCCATGCGATGGCGCTGTGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 1500 4549 27 89
Genomic Location (Zv9):
Chromosome 23 (position 25819558)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25605678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTTTCGCCGTCACCCTGTATGGAGGAGAAGTGTACTGGACAGACTGG[C/T]GAACCAACACTCTGGCGAGGGCCAACAAGTGGACGGGACACAACGTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 1605 4549 29 89
Genomic Location (Zv9):
Chromosome 23 (position 25812704)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25598824
KASP Assay ID:
2261-7814.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTAYGCTCGTCAGATTGAGATCAGAGGGGTTGACATTGATAATCCCTA[T/G]TACAACTACATCATCTCCTTCACTGTCCCYGACATTGACAATGTGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Essential Splice Site 1751 4549 31 89
Genomic Location (Zv9):
Chromosome 23 (position 25809998)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25596118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGGCACCAACCACACACTGCTGTTCACCAAKCAGAAAGGCCCAGTTGG[T/C]GAGTGAGCTGTCTTACATACCTTTTGTTTGCCCAAAGCTAAAAGATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 2033 4549 38 89
Genomic Location (Zv9):
Chromosome 23 (position 25803153)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25589273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACTGTTTGTGTGTCCAGGTATCTGTTTTGGACAGAGTGGGGTCAGTA[T/A]CCACGAATTGAAAGATCTCGCCTGGACGGTTCTGAGAGAGTAGTTCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 2704 4549 50 89
Genomic Location (Zv9):
Chromosome 23 (position 25788481)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25574601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCCGCAGAAAAAAGGCAACAGAAATGTTCAGAGAACAACTTTGCGTG[T/A]CCGAGCGGGCGCTGCATTCCCATGAGCTGGACCTGTGACAAAGAGAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Essential Splice Site 2732 4549 51 89
Genomic Location (Zv9):
Chromosome 23 (position 25787020)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25573140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATTCGACCTAAATTGTTTTGACAGTATGTTTTGCATTTGTTTTTTTA[G/A]AAAAGTTTTTCCAGTTCTGTGCATCTAATCAGTTTGAATGTGGAAACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088208 Nonsense 4513 4549 89 89
Genomic Location (Zv9):
Chromosome 23 (position 25740415)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25526535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATATTGTTTATCTCTCTCCCAGCCCACAAACTTCACAAACCCCGTGTA[C/A]GCCACGCTCTACATGGGTGCACATAACAGCCGTAACTCTCTGGCCAGCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link