taf6

Ensembl ID:
ENSDARG00000029135
ZFIN ID:
ZDB-GENE-040912-23
Description:
transcription initiation factor TFIID subunit 6 [Source:RefSeq peptide;Acc:NP_001004557]
Human Orthologue:
TAF6
Human Description:
TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa [Source:HGNC Symbol;
Mouse Orthologue:
Taf6
Mouse Description:
TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9111 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042901 Nonsense 409 636 11 14
ENSDART00000143810 Nonsense 360 587 10 13

The following transcripts of ENSDARG00000029135 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 63690254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATTAAAGCAGTGATGGAWGGGCCAGTGGTATCCAATATTGATAAGATT[G/T]GAGCTGATCATGTCCAGAGTCTATTACTGGTAAGTACCTTACAACAGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sfkvt6sf