tubgcp3

Ensembl ID:
ENSDARG00000029133
ZFIN ID:
ZDB-GENE-030616-538
Description:
gamma-tubulin complex component 3 [Source:RefSeq peptide;Acc:NP_001004513]
Human Orthologue:
TUBGCP3
Human Description:
tubulin, gamma complex associated protein 3 [Source:HGNC Symbol;Acc:18598]
Mouse Orthologue:
Tubgcp3
Mouse Description:
tubulin, gamma complex associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:2183752]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3339 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042064 Nonsense 887 909 22 22
ENSDART00000143228 Nonsense 877 899 22 22
Genomic Location:
Chromosome 1 (position 46946240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGAGAGTCTCCAGTTCCTCAGTTTTCGTCTGGATTTCAATGAACATTA[C/A]AAGGCCCGTGACCCCCGCCTGCGGCCCTCGCTCGGGGCCACCAGAGGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/le456axa