adamts15a

Ensembl ID:
ENSDARG00000029124
ZFIN ID:
ZDB-GENE-060526-203
Description:
a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15 [Sour
Human Orthologue:
ADAMTS15
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 15 [Source:HGNC Symbol;Acc:16305]
Mouse Orthologue:
Adamts15
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15 Gene

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10262 Nonsense Available for shipment Available now
sa420 Nonsense Available for shipment Available now
sa20449 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098294 Nonsense 33 935 1 9
ENSDART00000134624 Nonsense 33 958 1 8
Genomic Location:
Chromosome 5 (position 31818123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGTGGAGAATTGTGAATTCAATGCAGAGCCAGTTATGCGTGCCCATC[A/T]GAATGGATCATGTAAAGAACAGTTTAGTCGATGATGAGGACAGTATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098294 Nonsense 119 935 1 9
ENSDART00000134624 Nonsense 119 958 1 8
Genomic Location:
Chromosome 5 (position 31818381)
KASP Assay ID:
554-0281.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGTGAGGTGAATTCTGATCCCTATTCCTACGCTGCGCTCAGCTTGTGC[A/T]AGGGTCTCCAGGGCGCATTCGGATACGACGGCTGGGAATATTTCATCAAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098294 Nonsense 290 935 1 9
ENSDART00000134624 Nonsense 290 958 1 8
Genomic Location:
Chromosome 5 (position 31818894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGGTTTCCGGGAACGCGGCGATGACCCTGCGTAACTTCTGCACCTGG[C/T]AGAAGAAGCTGAACAAAAACAATGACAAGCATCCGGAGTACTGGGATACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p2h3hxat