gem

Ensembl ID:
ENSDARG00000029112
ZFIN ID:
ZDB-GENE-060825-251
Description:
GTP-binding protein GEM [Source:RefSeq peptide;Acc:NP_001039314]
Human Orthologue:
GEM
Human Description:
GTP binding protein overexpressed in skeletal muscle [Source:HGNC Symbol;Acc:4234]
Mouse Orthologue:
Gem
Mouse Description:
GTP binding protein (gene overexpressed in skeletal muscle) Gene [Source:MGI Symbol;Acc:MGI:99844]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16656 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048036 Nonsense 30 291 1 4
Genomic Location:
Chromosome 16 (position 29017552)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTACAGCATCACCTGCACCGGTGGAGCATCTGCGGAACGGAYGGAGGG[C/T]AGCTGCTCAACGATGCTTTCCCGCGYTCYRACATCAGTRTGTCCCGGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vie57z8i