ftr51

Ensembl ID:
ENSDARG00000029105
ZFIN ID:
ZDB-GENE-081104-54
Description:
FinTRIM family protein [Source:UniProtKB/TrEMBL;Acc:B5WY16]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16228 Nonsense Available for shipment Available now
sa20313 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099920 None None 285 None 4
ENSDART00000132323 Nonsense 55 530 1 6
Genomic Location:
Chromosome 4 (position 60401117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGCTGGGATCAGGAGGAGGAGAAGGGAGTCTACAGCTGCCCTCAGTG[C/A]AGACAGACCTTCAGTCYCAGACCYGCGCTAGCTAAAAACACCATCCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099920 Nonsense 173 285 3 4
ENSDART00000132323 Nonsense 248 530 3 6
Genomic Location:
Chromosome 4 (position 60405275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAGAGGATCTTCACTGAGCTCATCCAGCACATTGAGAGAAGCCGATCC[G/T]AGGTCACTCGGCAGATCCGAGATCAGGAGAAATCTGCCGTGAGTCGAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/egrrel6g