chchd1

Ensembl ID:
ENSDARG00000029100
ZFIN ID:
ZDB-GENE-060810-176
Description:
coiled-coil-helix-coiled-coil-helix domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_00107
Human Orthologue:
CHCHD1
Human Description:
coiled-coil-helix-coiled-coil-helix domain containing 1 [Source:HGNC Symbol;Acc:23518]
Mouse Orthologue:
Chchd1
Mouse Description:
coiled-coil-helix-coiled-coil-helix domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913371]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6294 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100941 Nonsense 78 113 2 3
Genomic Location:
Chromosome 13 (position 21911169)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTTAACAATGCATTCTGCCCTCAAGAAGTCACCGCTTTCTACACATG[T/A]GTCGAAAAGGTACTGCAGAYAGCAACTCACTSTCCTCRGGATATCCTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n8ettg45