copeb

Ensembl ID:
ENSDARG00000029072
ZFIN ID:
ZDB-GENE-021115-9
Description:
Krueppel-like factor 6 [Source:RefSeq peptide;Acc:NP_958869]
Human Orthologue:
KLF6
Human Description:
Kruppel-like factor 6 [Source:HGNC Symbol;Acc:2235]
Mouse Orthologue:
Klf6
Mouse Description:
Kruppel-like factor 6 Gene [Source:MGI Symbol;Acc:MGI:1346318]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32473 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6755 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033494 Essential Splice Site 35 283 2 5
ENSDART00000147849 Essential Splice Site 35 274 2 4
Genomic Location:
Chromosome 24 (position 4224954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAGGAAACCCGCATGCTAAAATTGTGTTTTTTTTCCTGTTTCGAATC[A/T]GACATGTTTGGAGCTGGAGAGATATTTGCAGAGCGAGCCTTACGTCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033494 Essential Splice Site None 283 4 5
ENSDART00000147849   None 274 4 4
Genomic Location:
Chromosome 24 (position 4221203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGATGATTTATTTTAAAAAANNTGTAAAACAAAAAACAAAAAACAGAG[C/T]GAGTGAATGGTGTGTTGTATGGTGCATGATGAACTCCTGGACTATACACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link