copeb

Ensembl ID:
ENSDARG00000029072
ZFIN ID:
ZDB-GENE-021115-9
Description:
Krueppel-like factor 6 [Source:RefSeq peptide;Acc:NP_958869]
Human Orthologue:
KLF6
Human Description:
Kruppel-like factor 6 [Source:HGNC Symbol;Acc:2235]
Mouse Orthologue:
Klf6
Mouse Description:
Kruppel-like factor 6 Gene [Source:MGI Symbol;Acc:MGI:1346318]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6755 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033494 Essential Splice Site None 283 4 5
ENSDART00000147849 None None 274 4 4
Genomic Location:
Chromosome 24 (position 4221203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGATGATTTATTTTAAAAAANNTGTAAAACAAAAAACAAAAAACAGAG[C/T]GAGTGAATGGTGTGTTGTATGGTGCATGATGAACTCCTGGACTATACACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6rdvg9ew