creld2

Ensembl ID:
ENSDARG00000029071
ZFIN ID:
ZDB-GENE-040426-1626
Description:
Cysteine-rich with EGF-like domain protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXF6]
Human Orthologue:
CRELD2
Human Description:
cysteine-rich with EGF-like domains 2 [Source:HGNC Symbol;Acc:28150]
Mouse Orthologue:
Creld2
Mouse Description:
cysteine-rich with EGF-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:1923987]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12172 Nonsense Available for shipment Available now
sa20294 Nonsense Mutation detected in F1 DNA During 2016
sa40308 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048383 Nonsense 175 341 5 10

The following transcripts of ENSDARG00000029071 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 26387981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACAAGGGCTGGAAATGGGAAATGCAGTTGTGATGAAGGATATGATGGG[G/T]AGTTTTGTCTGGACTGCAGTGATGGATATTTTAATTCACTGAGGAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048383 Nonsense 263 341 8 10

The following transcripts of ENSDARG00000029071 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 26380707)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTAATTAATATTTTTGTCTGTGTTTGTCCATGTAAGCATGTGATATC[A/T]GATGCACTGGATGCAAAGGAGATGGTGCCAGTAGCTGCCTTAACTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048383 Essential Splice Site 318 341 9 10

The following transcripts of ENSDARG00000029071 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 26379874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGATAACCAGCATTGCCTAAACACAGATGGTTCTTTCTCCTGTGAAG[G/A]TTTGTTGAAACAATATTATGTGCCCTTTGCAGAGATTACACTGGTTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link