creld2

Ensembl ID:
ENSDARG00000029071
ZFIN ID:
ZDB-GENE-040426-1626
Description:
Cysteine-rich with EGF-like domain protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXF6]
Human Orthologue:
CRELD2
Human Description:
cysteine-rich with EGF-like domains 2 [Source:HGNC Symbol;Acc:28150]
Mouse Orthologue:
Creld2
Mouse Description:
cysteine-rich with EGF-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:1923987]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12172 Nonsense Available for shipment Available now
sa20294 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048383 Nonsense 175 341 5 10

The following transcripts of ENSDARG00000029071 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 26387981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACAAGGGCTGGAAATGGGAAATGCAGTTGTGATGAAGGATATGATGGG[G/T]AGTTTTGTCTGGACTGCAGTGATGGATATTTTAATTCACTGAGGAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048383 Nonsense 263 341 8 10

The following transcripts of ENSDARG00000029071 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 26380707)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTAATTAATATTTTTGTCTGTGTTTGTCCATGTAAGCATGTGATATC[A/T]GATGCACTGGATGCAAAGGAGATGGTGCCAGTAGCTGCCTTAACTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8stto4iy