tnni2a.4

Ensembl ID:
ENSDARG00000029069
ZFIN ID:
ZDB-GENE-040625-119
Description:
troponin I, skeletal, fast 2a.4 [Source:RefSeq peptide;Acc:NP_001009901]
Human Orthologue:
TNNI2
Human Description:
troponin I type 2 (skeletal, fast) [Source:HGNC Symbol;Acc:11946]
Mouse Orthologue:
Tnni2
Mouse Description:
troponin I, skeletal, fast 2 Gene [Source:MGI Symbol;Acc:MGI:105070]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa58 Nonsense Confirmed mutation in F2 line During 2014
sa107 Nonsense Available for shipment Available now
sa13015 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa58
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036275 Nonsense 67 176 5 7
Genomic Location:
Chromosome 25 (position 32127498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTGTTTTGTGTTGTACTTCCAGGATTTGTGCAAAAAGCTGCACCAA[C/T]AGATTGACAAGGTTGATGAGGAGAGATATGACATGGAGGCCAAGGTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036275 Nonsense 81 176 5 7
Genomic Location:
Chromosome 25 (position 32127540)
KASP Assay ID:
554-0035.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACCAACAGATTGACAAGGTTGATGAGGAGAGATATGACATGGAGGCC[A/T]AGGTTGCCAAGGCAGACAAGGAGGTGCAGTAGATCCATTTCTAGGTGTCC
Associated Phenotype:
Data not yet available

Mutation Details

Allele Name:
sa13015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036275 Nonsense 90 176 6 7
Genomic Location:
Chromosome 25 (position 32127659)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGAATATCTCTGAGCTCCATTTTRAYCGWGTAATRTGTCTCTAGATT[G/T]AGGATCTGAAGATCAARGTSATCGACCTGAAGGGCAAGTTCAAGAAGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e855k2g0