rhcgl2

Ensembl ID:
ENSDARG00000029066
ZFIN IDs:
ZDB-GENE-040426-2595, ZDB-GENE-040426-2595
Description:
Ammonium transporter Rh type C-like 2 [Source:UniProtKB/Swiss-Prot;Acc:Q8JI14]
Human Orthologue:
RHCG
Human Description:
Rh family, C glycoprotein [Source:HGNC Symbol;Acc:18140]
Mouse Orthologue:
Rhcg
Mouse Description:
Rhesus blood group-associated C glycoprotein Gene [Source:MGI Symbol;Acc:MGI:1888517]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16468 Nonsense Available for shipment Available now
sa44242 Nonsense Mutation detected in F1 DNA During 2016
sa30208 Nonsense Mutation detected in F1 DNA During 2016
sa44241 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014573 Nonsense 145 329 3 12
ENSDART00000048028 Nonsense 145 488 3 11
ENSDART00000053518 Nonsense 145 488 3 11
Genomic Location (Zv9):
Chromosome 25 (position 8792484)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8516280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTCATGACTGTTTACKSTGTGTTCAGMTTGATCAATGCAGATTTCTG[T/A]GYGGCCRGTTGTCTAATCGCATACGGTGCGGTGCTGGGGAAGGTCAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014573 Nonsense 238 329 4 12
ENSDART00000048028 Nonsense 238 488 4 11
ENSDART00000053518 Nonsense 238 488 4 11
Genomic Location (Zv9):
Chromosome 25 (position 8791280)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8515076
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACCATATGAACGGGTCCGTCTACCACTCGGACGTATTCGCCATGATC[G/T]GTAAGAATAAAGCCATTACAAACAAACTTTCAAGCTCTACAGTGTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014573 Nonsense 243 329 5 12
ENSDART00000048028 Nonsense 243 488 5 11
ENSDART00000053518 Nonsense 243 488 5 11
Genomic Location (Zv9):
Chromosome 25 (position 8790926)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8514722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATAGACTGGGTTGTTGTTGTTGTTTTTTCAGGAACACTTTTCCTGTG[G/A]ATGTTTTGGCCGAGTTTTAACTCTGCTATTTGTAATCATGGAGACGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014573 Essential Splice Site 307 329 6 12
ENSDART00000048028 Missense 308 488 6 11
ENSDART00000053518 Missense 308 488 6 11
Genomic Location (Zv9):
Chromosome 25 (position 8789618)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8513414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTAGGTGCACATTCAGAACTCTACCCTGGCGGGTGGCGTGGCCGTGG[G/A]CACCGCAGCAGAGTTCATGCTGATGCCGTACGGCTCTTTGATCGTAGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link