rbb4

Ensembl ID:
ENSDARG00000029058
ZFIN ID:
ZDB-GENE-030131-445
Description:
Histone-binding protein RBBP4 [Source:UniProtKB/Swiss-Prot;Acc:Q6P3H7]
Human Orthologue:
RBBP4
Human Description:
retinoblastoma binding protein 4 [Source:HGNC Symbol;Acc:9887]
Mouse Orthologue:
Rbbp4
Mouse Description:
retinoblastoma binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1194912]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15025 Nonsense Available for shipment Available now
sa23554 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048144 Nonsense 22 424 2 12
ENSDART00000130326 Nonsense 22 444 2 13

The following transcripts of ENSDARG00000029058 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 32250432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTGCATTTGATGACGCGGTGGAGGAGAGRGTGATAAATGAAGAATAT[A/T]AAATATGGAAGAAAAACACTCCGTTTCTKTACGATCTGGTGATGACCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048144 Nonsense 235 424 6 12
ENSDART00000130326 Nonsense 235 444 6 13

The following transcripts of ENSDARG00000029058 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 32247007)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAAAACTATTTTCACTGGTCACACTGCTGTAGTGGAGGATGTGTCCTG[G/A]CACCTGCTGCATGAGTCTCTCTTCGGGTCTGTTGCAGATGACCAAAAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rqzxk2bl