si:dkey-19f23.3

Ensembl ID:
ENSDARG00000029057
ZFIN ID:
ZDB-GENE-060503-338
Description:
transmembrane 6 superfamily member 1-like [Source:RefSeq peptide;Acc:NP_001074130]
Human Orthologues:
TM6SF1, TM6SF2
Human Descriptions:
transmembrane 6 superfamily member 1 [Source:HGNC Symbol;Acc:11860]
transmembrane 6 superfamily member 2 [Source:HGNC Symbol;Acc:11861]
Mouse Orthologues:
Tm6sf1, Tm6sf2
Mouse Descriptions:
transmembrane 6 superfamily member 1 Gene [Source:MGI Symbol;Acc:MGI:1933209]
transmembrane 6 superfamily member 2 Gene [Source:MGI Symbol;Acc:MGI:1933210]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19290 Nonsense Mutation detected in F1 DNA During 2017
sa11951 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040601 Nonsense 251 374 9 11
ENSDART00000145260 Nonsense 251 321 9 11
ENSDART00000040601 Nonsense 251 374 9 11
ENSDART00000145260 Nonsense 251 321 9 11
Genomic Location (Zv9):
Chromosome 22 (position 18031801)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17782736
KASP Assay ID:
2261-6710.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTCCTGGATTGCCCGCTGGAAATCCTCAACAAATATGTGACCGAGTA[T/A]GAACCGTATCTAAAGGATCCCGTGGGCTTCCCCAAAGTTATGGTGAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040601 Nonsense 251 374 9 11
ENSDART00000145260 Nonsense 251 321 9 11
ENSDART00000040601 Nonsense 251 374 9 11
ENSDART00000145260 Nonsense 251 321 9 11
Genomic Location (Zv9):
Chromosome 22 (position 18031801)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17782736
KASP Assay ID:
2261-6710.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTCCTGGATTGCCCGCTGGAAATCCTCAACAAATATGTGACYGAGTA[T/A]GAACCGTATCTAAAGGATCCCGTGGGCTTCCCCAAAGTTATGGTGAGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link