GBE1 (2 of 2)

Ensembl ID:
ENSDARG00000029051
Description:
glucan (1,4-alpha-), branching enzyme 1 [Source:HGNC Symbol;Acc:4180]
Human Orthologue:
GBE1
Human Description:
glucan (1,4-alpha-), branching enzyme 1 [Source:HGNC Symbol;Acc:4180]
Mouse Orthologue:
Gbe1
Mouse Description:
glucan (1,4-alpha-), branching enzyme 1 Gene [Source:MGI Symbol;Acc:MGI:1921435]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38798 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064741 Splice Site, Nonsense 31 687 1 16
Genomic Location (Zv9):
Chromosome 10 (position 24480169)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24079521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTACAGACAGATCCGTACATTGCACATTATGAGGGAGAGCTGCGTAGA[A/T]GGTAAACGCCCTTTTGATAAACTTTTAATGAATTCCACTTGCCTGATTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link