peli2

Ensembl ID:
ENSDARG00000029045
ZFIN ID:
ZDB-GENE-040718-360
Description:
protein pellino homolog 2 [Source:RefSeq peptide;Acc:NP_001002616]
Human Orthologue:
PELI3
Human Description:
pellino homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:30010]
Mouse Orthologue:
Peli3
Mouse Description:
pellino 3 Gene [Source:MGI Symbol;Acc:MGI:1924963]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36504 Nonsense Mutation detected in F1 DNA During 2017
sa23164 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049503 Nonsense 46 428 2 6
Genomic Location (Zv9):
Chromosome 17 (position 44092722)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43932400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTCCCCAATGGTGACAGAGGGCGAAGGAAAAGCCGGTTTGCCCTTTA[C/A]AAGAGAGCCAAAGCCAATGGGGTCAAGCCCAGCACTGTACACATCCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049503 Essential Splice Site 232 428 5 6
Genomic Location (Zv9):
Chromosome 17 (position 44121690)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43961368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTACACACTGAGAGAAACACGCTCTGCTCAAACTCGAGGAAAATTGG[T/C]TAGTATGTGAGCGGTGTCTGTTCAGTGTAGTTTACCGCCTGTTTTCTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link