si:ch211-137i24.2

Ensembl ID:
ENSDARG00000029039
ZFIN ID:
ZDB-GENE-060526-38
Description:
Novel protein containing a DHHC zinc finger domain [Source:UniProtKB/TrEMBL;Acc:A2BEM9]
Human Orthologue:
ZDHHC23
Human Description:
zinc finger, DHHC-type containing 23 [Source:HGNC Symbol;Acc:28654]
Mouse Orthologue:
Zdhhc23
Mouse Description:
zinc finger, DHHC domain containing 23 Gene [Source:MGI Symbol;Acc:MGI:2685625]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20407 Essential Splice Site Available for shipment Available now
sa40419 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31434 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041905 Essential Splice Site 44 407 1 4
ENSDART00000143563   None 363 None 3
Genomic Location (Zv9):
Chromosome 5 (position 25951628)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23778893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGTACTGCTGCTGTGACTGTGAAGAACTCGACGATGCCTGCGAAAGG[T/C]TAGAAGTCAACTGTTTTAAAGGAACCTACATCTTTTCATACAAGCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041905 Essential Splice Site 44 407 2 4
ENSDART00000143563   None 363 None 3
Genomic Location (Zv9):
Chromosome 5 (position 25956858)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23784123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATTGTATTGAATTTGTATTTTTTCTGTTTTTCCTCTATTTTTATTTA[T/A]AAGGTTACTCAGAGGAGAGCCAGACAAGCCAGACGTGTTTTCGCGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041905 Nonsense 90 407 2 4
ENSDART00000143563 Nonsense 46 363 1 3
Genomic Location (Zv9):
Chromosome 5 (position 25956996)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23784261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCGTAGGACCTCTTCGACTGGAACTCTCTGTTTTACCTCCCATGGTTT[T/A]AATCCCTGGCCTGTTGCGAGTCGCAGCGATTAATTGCTTGTTGGGAGTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link